ID: 1020746272

View in Genome Browser
Species Human (GRCh38)
Location 7:12082095-12082117
Sequence AGTGTTAAGGGGCCATATAT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1020746272_1020746282 7 Left 1020746272 7:12082095-12082117 CCTATATATGGCCCCTTAACACT No data
Right 1020746282 7:12082125-12082147 GGATGGTTGTGGTTTGGAGGTGG No data
1020746272_1020746280 1 Left 1020746272 7:12082095-12082117 CCTATATATGGCCCCTTAACACT No data
Right 1020746280 7:12082119-12082141 ATGGATGGATGGTTGTGGTTTGG No data
1020746272_1020746278 -10 Left 1020746272 7:12082095-12082117 CCTATATATGGCCCCTTAACACT No data
Right 1020746278 7:12082108-12082130 CCTTAACACTAATGGATGGATGG No data
1020746272_1020746279 -4 Left 1020746272 7:12082095-12082117 CCTATATATGGCCCCTTAACACT No data
Right 1020746279 7:12082114-12082136 CACTAATGGATGGATGGTTGTGG No data
1020746272_1020746283 15 Left 1020746272 7:12082095-12082117 CCTATATATGGCCCCTTAACACT No data
Right 1020746283 7:12082133-12082155 GTGGTTTGGAGGTGGTAACGAGG No data
1020746272_1020746281 4 Left 1020746272 7:12082095-12082117 CCTATATATGGCCCCTTAACACT No data
Right 1020746281 7:12082122-12082144 GATGGATGGTTGTGGTTTGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1020746272 Original CRISPR AGTGTTAAGGGGCCATATAT AGG (reversed) Intergenic
No off target data available for this crispr