ID: 1020746273

View in Genome Browser
Species Human (GRCh38)
Location 7:12082100-12082122
Sequence ATATGGCCCCTTAACACTAA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1020746266_1020746273 -3 Left 1020746266 7:12082080-12082102 CCACCTACCATCCCTCCTATATA No data
Right 1020746273 7:12082100-12082122 ATATGGCCCCTTAACACTAATGG No data
1020746267_1020746273 -6 Left 1020746267 7:12082083-12082105 CCTACCATCCCTCCTATATATGG No data
Right 1020746273 7:12082100-12082122 ATATGGCCCCTTAACACTAATGG No data
1020746265_1020746273 -2 Left 1020746265 7:12082079-12082101 CCCACCTACCATCCCTCCTATAT No data
Right 1020746273 7:12082100-12082122 ATATGGCCCCTTAACACTAATGG No data
1020746269_1020746273 -10 Left 1020746269 7:12082087-12082109 CCATCCCTCCTATATATGGCCCC No data
Right 1020746273 7:12082100-12082122 ATATGGCCCCTTAACACTAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1020746273 Original CRISPR ATATGGCCCCTTAACACTAA TGG Intergenic
No off target data available for this crispr