ID: 1020746274

View in Genome Browser
Species Human (GRCh38)
Location 7:12082104-12082126
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1020746267_1020746274 -2 Left 1020746267 7:12082083-12082105 CCTACCATCCCTCCTATATATGG No data
Right 1020746274 7:12082104-12082126 GGCCCCTTAACACTAATGGATGG No data
1020746265_1020746274 2 Left 1020746265 7:12082079-12082101 CCCACCTACCATCCCTCCTATAT No data
Right 1020746274 7:12082104-12082126 GGCCCCTTAACACTAATGGATGG No data
1020746270_1020746274 -10 Left 1020746270 7:12082091-12082113 CCCTCCTATATATGGCCCCTTAA No data
Right 1020746274 7:12082104-12082126 GGCCCCTTAACACTAATGGATGG No data
1020746266_1020746274 1 Left 1020746266 7:12082080-12082102 CCACCTACCATCCCTCCTATATA No data
Right 1020746274 7:12082104-12082126 GGCCCCTTAACACTAATGGATGG No data
1020746269_1020746274 -6 Left 1020746269 7:12082087-12082109 CCATCCCTCCTATATATGGCCCC No data
Right 1020746274 7:12082104-12082126 GGCCCCTTAACACTAATGGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1020746274 Original CRISPR GGCCCCTTAACACTAATGGA TGG Intergenic