ID: 1020746277

View in Genome Browser
Species Human (GRCh38)
Location 7:12082108-12082130
Sequence CCATCCATCCATTAGTGTTA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1020746277_1020746283 2 Left 1020746277 7:12082108-12082130 CCTTAACACTAATGGATGGATGG No data
Right 1020746283 7:12082133-12082155 GTGGTTTGGAGGTGGTAACGAGG No data
1020746277_1020746281 -9 Left 1020746277 7:12082108-12082130 CCTTAACACTAATGGATGGATGG No data
Right 1020746281 7:12082122-12082144 GATGGATGGTTGTGGTTTGGAGG No data
1020746277_1020746282 -6 Left 1020746277 7:12082108-12082130 CCTTAACACTAATGGATGGATGG No data
Right 1020746282 7:12082125-12082147 GGATGGTTGTGGTTTGGAGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1020746277 Original CRISPR CCATCCATCCATTAGTGTTA AGG (reversed) Intergenic
No off target data available for this crispr