ID: 1020746280

View in Genome Browser
Species Human (GRCh38)
Location 7:12082119-12082141
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1020746271_1020746280 4 Left 1020746271 7:12082092-12082114 CCTCCTATATATGGCCCCTTAAC No data
Right 1020746280 7:12082119-12082141 ATGGATGGATGGTTGTGGTTTGG No data
1020746270_1020746280 5 Left 1020746270 7:12082091-12082113 CCCTCCTATATATGGCCCCTTAA No data
Right 1020746280 7:12082119-12082141 ATGGATGGATGGTTGTGGTTTGG No data
1020746272_1020746280 1 Left 1020746272 7:12082095-12082117 CCTATATATGGCCCCTTAACACT No data
Right 1020746280 7:12082119-12082141 ATGGATGGATGGTTGTGGTTTGG No data
1020746275_1020746280 -10 Left 1020746275 7:12082106-12082128 CCCCTTAACACTAATGGATGGAT No data
Right 1020746280 7:12082119-12082141 ATGGATGGATGGTTGTGGTTTGG No data
1020746265_1020746280 17 Left 1020746265 7:12082079-12082101 CCCACCTACCATCCCTCCTATAT No data
Right 1020746280 7:12082119-12082141 ATGGATGGATGGTTGTGGTTTGG No data
1020746269_1020746280 9 Left 1020746269 7:12082087-12082109 CCATCCCTCCTATATATGGCCCC No data
Right 1020746280 7:12082119-12082141 ATGGATGGATGGTTGTGGTTTGG No data
1020746266_1020746280 16 Left 1020746266 7:12082080-12082102 CCACCTACCATCCCTCCTATATA No data
Right 1020746280 7:12082119-12082141 ATGGATGGATGGTTGTGGTTTGG No data
1020746267_1020746280 13 Left 1020746267 7:12082083-12082105 CCTACCATCCCTCCTATATATGG No data
Right 1020746280 7:12082119-12082141 ATGGATGGATGGTTGTGGTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1020746280 Original CRISPR ATGGATGGATGGTTGTGGTT TGG Intergenic