ID: 1020746281

View in Genome Browser
Species Human (GRCh38)
Location 7:12082122-12082144
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1020746265_1020746281 20 Left 1020746265 7:12082079-12082101 CCCACCTACCATCCCTCCTATAT No data
Right 1020746281 7:12082122-12082144 GATGGATGGTTGTGGTTTGGAGG No data
1020746266_1020746281 19 Left 1020746266 7:12082080-12082102 CCACCTACCATCCCTCCTATATA No data
Right 1020746281 7:12082122-12082144 GATGGATGGTTGTGGTTTGGAGG No data
1020746271_1020746281 7 Left 1020746271 7:12082092-12082114 CCTCCTATATATGGCCCCTTAAC No data
Right 1020746281 7:12082122-12082144 GATGGATGGTTGTGGTTTGGAGG No data
1020746275_1020746281 -7 Left 1020746275 7:12082106-12082128 CCCCTTAACACTAATGGATGGAT No data
Right 1020746281 7:12082122-12082144 GATGGATGGTTGTGGTTTGGAGG No data
1020746267_1020746281 16 Left 1020746267 7:12082083-12082105 CCTACCATCCCTCCTATATATGG No data
Right 1020746281 7:12082122-12082144 GATGGATGGTTGTGGTTTGGAGG No data
1020746270_1020746281 8 Left 1020746270 7:12082091-12082113 CCCTCCTATATATGGCCCCTTAA No data
Right 1020746281 7:12082122-12082144 GATGGATGGTTGTGGTTTGGAGG No data
1020746272_1020746281 4 Left 1020746272 7:12082095-12082117 CCTATATATGGCCCCTTAACACT No data
Right 1020746281 7:12082122-12082144 GATGGATGGTTGTGGTTTGGAGG No data
1020746276_1020746281 -8 Left 1020746276 7:12082107-12082129 CCCTTAACACTAATGGATGGATG No data
Right 1020746281 7:12082122-12082144 GATGGATGGTTGTGGTTTGGAGG No data
1020746269_1020746281 12 Left 1020746269 7:12082087-12082109 CCATCCCTCCTATATATGGCCCC No data
Right 1020746281 7:12082122-12082144 GATGGATGGTTGTGGTTTGGAGG No data
1020746277_1020746281 -9 Left 1020746277 7:12082108-12082130 CCTTAACACTAATGGATGGATGG No data
Right 1020746281 7:12082122-12082144 GATGGATGGTTGTGGTTTGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1020746281 Original CRISPR GATGGATGGTTGTGGTTTGG AGG Intergenic