ID: 1020746283

View in Genome Browser
Species Human (GRCh38)
Location 7:12082133-12082155
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1020746266_1020746283 30 Left 1020746266 7:12082080-12082102 CCACCTACCATCCCTCCTATATA No data
Right 1020746283 7:12082133-12082155 GTGGTTTGGAGGTGGTAACGAGG No data
1020746267_1020746283 27 Left 1020746267 7:12082083-12082105 CCTACCATCCCTCCTATATATGG No data
Right 1020746283 7:12082133-12082155 GTGGTTTGGAGGTGGTAACGAGG No data
1020746269_1020746283 23 Left 1020746269 7:12082087-12082109 CCATCCCTCCTATATATGGCCCC No data
Right 1020746283 7:12082133-12082155 GTGGTTTGGAGGTGGTAACGAGG No data
1020746276_1020746283 3 Left 1020746276 7:12082107-12082129 CCCTTAACACTAATGGATGGATG No data
Right 1020746283 7:12082133-12082155 GTGGTTTGGAGGTGGTAACGAGG No data
1020746272_1020746283 15 Left 1020746272 7:12082095-12082117 CCTATATATGGCCCCTTAACACT No data
Right 1020746283 7:12082133-12082155 GTGGTTTGGAGGTGGTAACGAGG No data
1020746277_1020746283 2 Left 1020746277 7:12082108-12082130 CCTTAACACTAATGGATGGATGG No data
Right 1020746283 7:12082133-12082155 GTGGTTTGGAGGTGGTAACGAGG No data
1020746270_1020746283 19 Left 1020746270 7:12082091-12082113 CCCTCCTATATATGGCCCCTTAA No data
Right 1020746283 7:12082133-12082155 GTGGTTTGGAGGTGGTAACGAGG No data
1020746275_1020746283 4 Left 1020746275 7:12082106-12082128 CCCCTTAACACTAATGGATGGAT No data
Right 1020746283 7:12082133-12082155 GTGGTTTGGAGGTGGTAACGAGG No data
1020746271_1020746283 18 Left 1020746271 7:12082092-12082114 CCTCCTATATATGGCCCCTTAAC No data
Right 1020746283 7:12082133-12082155 GTGGTTTGGAGGTGGTAACGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1020746283 Original CRISPR GTGGTTTGGAGGTGGTAACG AGG Intergenic