ID: 1020749260

View in Genome Browser
Species Human (GRCh38)
Location 7:12119869-12119891
Sequence GTGAAAAATACCATGACTTT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1020749258_1020749260 30 Left 1020749258 7:12119816-12119838 CCATTGAGTCTTACATTATAGCA No data
Right 1020749260 7:12119869-12119891 GTGAAAAATACCATGACTTTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1020749260 Original CRISPR GTGAAAAATACCATGACTTT AGG Intergenic
No off target data available for this crispr