ID: 1020760032

View in Genome Browser
Species Human (GRCh38)
Location 7:12257572-12257594
Sequence GGTTCGTATTCAGTAGGTCT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1020760028_1020760032 30 Left 1020760028 7:12257519-12257541 CCAAACTTAAATACACTATGCAG No data
Right 1020760032 7:12257572-12257594 GGTTCGTATTCAGTAGGTCTAGG No data
1020760029_1020760032 -1 Left 1020760029 7:12257550-12257572 CCTAGTATCTTGATAAAACTCAG No data
Right 1020760032 7:12257572-12257594 GGTTCGTATTCAGTAGGTCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1020760032 Original CRISPR GGTTCGTATTCAGTAGGTCT AGG Intergenic
No off target data available for this crispr