ID: 1020762261

View in Genome Browser
Species Human (GRCh38)
Location 7:12283208-12283230
Sequence AAAGAGTTACTATACTGGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1020762261_1020762266 -6 Left 1020762261 7:12283208-12283230 CCCTCCCAGTATAGTAACTCTTT No data
Right 1020762266 7:12283225-12283247 CTCTTTGCATGCTGGTCTTCTGG No data
1020762261_1020762267 18 Left 1020762261 7:12283208-12283230 CCCTCCCAGTATAGTAACTCTTT No data
Right 1020762267 7:12283249-12283271 ATCAAGAATCTAAAACGTCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1020762261 Original CRISPR AAAGAGTTACTATACTGGGA GGG (reversed) Intergenic
No off target data available for this crispr