ID: 1020766718

View in Genome Browser
Species Human (GRCh38)
Location 7:12331192-12331214
Sequence TCTTATCTGTAGTAGGAAGA AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 272
Summary {0: 1, 1: 0, 2: 1, 3: 22, 4: 248}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1020766715_1020766718 30 Left 1020766715 7:12331139-12331161 CCATTCTTAAGATACAGGCTTGT 0: 1
1: 0
2: 1
3: 16
4: 122
Right 1020766718 7:12331192-12331214 TCTTATCTGTAGTAGGAAGAAGG 0: 1
1: 0
2: 1
3: 22
4: 248

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1020766718 Original CRISPR TCTTATCTGTAGTAGGAAGA AGG Exonic
904250386 1:29219489-29219511 TTTTTTCTGGACTAGGAAGAGGG - Intronic
907257350 1:53190045-53190067 CCTTATCTGTAAAAGGGAGATGG - Intergenic
910868229 1:91807246-91807268 GCTTATCCCTAGTAGGAAAAAGG + Intronic
911088006 1:93995613-93995635 TAGCATCTGTTGTAGGAAGAGGG - Intronic
911626891 1:100133871-100133893 TCTTATTTTTAGTAGAGAGAGGG - Intronic
912635616 1:111289761-111289783 TCCTATCAGTCATAGGAAGAGGG - Intergenic
913329305 1:117654001-117654023 CCTCCTCTGTAGTAGGAAGTAGG + Intergenic
913683909 1:121213670-121213692 GCTTATCTGTAGTAGCCAGATGG + Intronic
914035748 1:144001285-144001307 GCTTATCTGTAGTAGCCAGACGG + Intergenic
914153707 1:145066660-145066682 GCTTATCTGTAGTAGCCAGACGG - Intronic
916630731 1:166609798-166609820 TCTTAATTGTACTATGAAGAAGG + Intergenic
917368869 1:174266046-174266068 TGATATCAGTAATAGGAAGAAGG - Intronic
919512982 1:198489636-198489658 TGTTATTTGTAGTAGAGAGAGGG - Intergenic
920471213 1:206232162-206232184 GCTTATCTGTAGTAGCCAGACGG + Intronic
920923785 1:210322340-210322362 TTTTATCTTTAGTAGAGAGAAGG - Intergenic
921307407 1:213810817-213810839 TCTTATCTGTAAAATGAGGATGG - Intergenic
921374331 1:214458575-214458597 TCTTATCTGTAAAATGGAGATGG - Intronic
921474201 1:215586348-215586370 TTTTATTTGTAATAGGAAGGTGG + Intronic
921687105 1:218102751-218102773 TTTTATTTTTTGTAGGAAGAGGG + Intergenic
922375116 1:224955945-224955967 TCTTATCGGTAGAATGAAGGAGG - Intronic
924360841 1:243240136-243240158 TCGTATTTGTAGTAGAAACAGGG - Intronic
1063223713 10:3994498-3994520 CCTTACCTGTAGAAGGAAGGAGG + Intergenic
1066053848 10:31662207-31662229 TCTTATCTTTAGTAGAGACAGGG + Intergenic
1068948233 10:62750998-62751020 TCCCATCTGTAGAAGGAAGGAGG + Intergenic
1069044861 10:63732559-63732581 TTTTATGTGTGGTAAGAAGAAGG + Intergenic
1074641478 10:115388056-115388078 TTTTATGTGTAGTGGGAAGAAGG + Intronic
1074897050 10:117786291-117786313 TCTTAACTATAGGAGGCAGAAGG - Intergenic
1078029009 11:7729480-7729502 TCCTCTCTGTAGTAGGAAAATGG - Intergenic
1080537000 11:33231416-33231438 TCTCATCTGTAGTGAAAAGAGGG - Intergenic
1081341174 11:41929467-41929489 TTGTATCTGTAGTAGACAGACGG + Intergenic
1082068619 11:47920684-47920706 ACCTTTCTGTAGTTGGAAGAGGG + Intergenic
1085240093 11:75045935-75045957 TTTTATGGGCAGTAGGAAGAAGG - Intergenic
1086351605 11:85947481-85947503 TCTTATGTGTAGCAGGAGGTGGG + Intergenic
1087156227 11:94907557-94907579 TCTTCTCTGTAAATGGAAGATGG - Intergenic
1087239153 11:95756129-95756151 TCTTTGGTGTAGTATGAAGATGG - Intergenic
1087923681 11:103895426-103895448 TCCTCTCTGTAATAGGGAGAAGG + Intergenic
1090602729 11:128389722-128389744 TCTGACCTGGAGTGGGAAGAAGG + Intergenic
1091068764 11:132543045-132543067 TCTTGTCTATTGTGGGAAGAGGG + Intronic
1093703803 12:22253137-22253159 TCTAATTTGTAGGAGGAAGCGGG - Intronic
1095634005 12:44409857-44409879 TCTTATTTTTGGTAGGAGGAGGG + Intergenic
1096074194 12:48791859-48791881 TCGTATTTGTAGTAGAGAGACGG + Intergenic
1097585021 12:61504933-61504955 CCTTTTCTGTAGTGGGAAGCAGG - Intergenic
1098276865 12:68821408-68821430 TCTTAACTGTAGTTCGAGGATGG - Intronic
1098999448 12:77160926-77160948 TCTCATTTGTAGAAGGAAGTGGG - Intergenic
1099982907 12:89627711-89627733 TCTTATCTGTAGGAACAAAATGG + Exonic
1100806866 12:98294576-98294598 TCTCATTCCTAGTAGGAAGAAGG + Intergenic
1100996980 12:100311886-100311908 TCTTATATGTAGTCGTTAGAGGG + Intronic
1101403429 12:104407842-104407864 TCCTATCTATACTATGAAGAAGG - Intergenic
1101771636 12:107757121-107757143 TCTTATCAGTAGAAAGAATATGG - Intronic
1102019207 12:109670092-109670114 TCTTATCTGAAATAAAAAGAGGG - Intergenic
1102398783 12:112610808-112610830 TCTTATCTTTAGTAGAGACAGGG + Intronic
1108144084 13:47458485-47458507 TCTTATTTTTTGTAGCAAGATGG + Intergenic
1109036661 13:57271070-57271092 TCTTTTCAATAGTATGAAGAAGG - Intergenic
1109549765 13:63879060-63879082 TCATATCCGTTGTAGGAACATGG + Intergenic
1109900112 13:68757347-68757369 TCTTTTCTGTAGCAAGAAGAGGG + Intergenic
1113392136 13:109908072-109908094 TCCTAACTGTGGTATGAAGATGG - Intergenic
1113567997 13:111330527-111330549 TTTTATCTGTAGTCAGAGGAAGG - Intronic
1114928784 14:27440450-27440472 TTTTATCTGTAGTATGAAAGAGG - Intergenic
1115170449 14:30499019-30499041 TATTATCTGTAGATAGAAGATGG - Intergenic
1116008785 14:39326043-39326065 TCTTTTCTGTGGTCGTAAGAAGG + Intronic
1117028171 14:51642701-51642723 GCATTTCTGTAGGAGGAAGATGG + Intronic
1117953620 14:61106363-61106385 TCTTCTGGGTAGTAGCAAGATGG + Intergenic
1119048265 14:71340318-71340340 TCTTATCTGTTGTAGGACTTTGG + Intronic
1120290356 14:82561811-82561833 TTTTTTCTGTAGTACTAAGAAGG + Intergenic
1122927760 14:104915663-104915685 ACATATCTGTTGGAGGAAGACGG + Intergenic
1125195750 15:37044103-37044125 TCTTATCTGTAGAATGGAGATGG - Intronic
1125464283 15:39934926-39934948 TCTTAGCTGTAGTAGAGAGAGGG + Intronic
1126909725 15:53404907-53404929 TCTTATCTGTAAAATGCAGATGG + Intergenic
1129208263 15:74050228-74050250 GCTCCTCTGTAGGAGGAAGATGG - Intergenic
1130154881 15:81341673-81341695 TCTTATCTTTAGAAGGTGGAGGG - Intronic
1132419076 15:101649575-101649597 GCTTATCTGTGGTGAGAAGATGG - Intronic
1133072426 16:3255142-3255164 TCTTATTTTTAGTAGGAACGGGG - Intronic
1133533387 16:6676091-6676113 TATTATCAGAAGTAGGTAGAAGG + Intronic
1135345735 16:21687046-21687068 TCTGATCTGAAGTAGGAAGTTGG + Intronic
1137041359 16:35615814-35615836 TTTTATGGGTAGTAGGAAGAAGG + Intergenic
1140440497 16:74984350-74984372 TCTCACCTGTAGAAGGGAGATGG - Intronic
1142525671 17:538676-538698 TCTTATCTGTGAAATGAAGATGG - Intronic
1142626594 17:1196255-1196277 TTGTATTTGTAGTAGAAAGAGGG - Intronic
1144398242 17:14867102-14867124 CTGTATCTGTAGCAGGAAGAGGG + Intergenic
1145071517 17:19813086-19813108 TATTATCTGGAGTAGCAAAATGG - Intronic
1145390206 17:22449731-22449753 AATTATCTGTATCAGGAAGAGGG - Intergenic
1146404226 17:32523312-32523334 TCTTGTCTGTAAAAGGAAGTTGG - Intronic
1147343984 17:39774830-39774852 TCTTTTTTGTTTTAGGAAGATGG - Intronic
1150010915 17:61502698-61502720 TCTGAGATGTAGTAGGAAAACGG + Intergenic
1150324634 17:64246892-64246914 TCTTATCTGCAGCAAGAAAAGGG - Intronic
1151401868 17:73861110-73861132 TCTTAGGGGTAGGAGGAAGAGGG - Intergenic
1151666463 17:75547958-75547980 CCATATCTGTATCAGGAAGAAGG - Intronic
1153206566 18:2709613-2709635 AATTATCTTTAGTAGGAAAAAGG - Intronic
1153381272 18:4442170-4442192 TATTATTTTTAGTAGAAAGAGGG + Intronic
1154093060 18:11382775-11382797 TCTTAGCTATAGGAGGAAAATGG + Intergenic
1155085633 18:22454962-22454984 TCTTATCTGAAGTGGAAAAAAGG - Intergenic
1156593078 18:38513282-38513304 TCTTATCAGTAGTGTGAAAATGG + Intergenic
1157030722 18:43904308-43904330 GCTTCTCTGAAGTAGGAAAAAGG - Intergenic
1157105005 18:44765824-44765846 TGTCATAGGTAGTAGGAAGAGGG - Intronic
1157266896 18:46232501-46232523 TTTTATCTGTACTAGGATTAAGG - Intronic
1157431192 18:47628124-47628146 TTTTATCTGTTGCAGGAAAATGG + Intergenic
1157611533 18:48959657-48959679 TTTTATCTGTAGTAGGGAATTGG + Intergenic
1158566305 18:58556929-58556951 TCTTATGTGGAATAGGAAGCTGG - Intronic
1163087409 19:14992381-14992403 TCTTATCTGTAAAAGGGAGCTGG - Intronic
1163326207 19:16604928-16604950 TCTTACCTGTGGTGGGAAAATGG - Intronic
1163882095 19:19933930-19933952 TCTTATGTGTAGTAAGGATACGG - Exonic
1163995060 19:21037288-21037310 TCTTATTTTTAGTAGAGAGAGGG + Intronic
1164023768 19:21331586-21331608 TCTGATCTCTAGAAGGAAGGAGG - Intergenic
1164203794 19:23041072-23041094 TCTTTACTGTAGTGCGAAGATGG - Intergenic
1165048893 19:33128687-33128709 TTTTATCTTTATTGGGAAGAAGG + Intronic
1165407795 19:35641732-35641754 GCTTATCTGCAACAGGAAGAGGG - Exonic
1165796380 19:38522427-38522449 TTTTATTTTTTGTAGGAAGAGGG - Intronic
1165826085 19:38706589-38706611 TTTTATTTTTAGTAGGAACAGGG + Intronic
1166020721 19:40026463-40026485 TCTTTTTTCTAGTGGGAAGATGG + Intergenic
925395547 2:3530860-3530882 TATTAGTAGTAGTAGGAAGAAGG + Intergenic
925395553 2:3530923-3530945 TATTAGTAGTAGTAGGAAGAAGG + Intergenic
926064938 2:9831067-9831089 TCTTCTCTCTAGCAGGAACATGG + Intergenic
927203062 2:20590421-20590443 CCTTCTCTGTAGAAGGATGATGG + Intronic
927545283 2:23947058-23947080 TCTTATTTGTAGTAGTGACAGGG + Intronic
927562474 2:24083867-24083889 CCTTATCTGTAGAATTAAGATGG + Intronic
927573393 2:24179898-24179920 TCATCTCTCTAGTAGGAAGTGGG + Intronic
931014630 2:57962204-57962226 CCTTATCTGTAGGATGAAGAGGG - Intronic
931446545 2:62331738-62331760 AAGTATCTGTATTAGGAAGAAGG - Intergenic
931859326 2:66337665-66337687 CCTTATCTGTAATATGAGGAGGG + Intergenic
932087159 2:68772591-68772613 TCTTATCTGTCCTAGAAAGAGGG - Intronic
934577643 2:95413069-95413091 TCTTCTCGGTAGAAGGGAGAAGG + Exonic
934639934 2:96021772-96021794 TCTTCTCGGTAGAAGGGAGAAGG + Intergenic
934793712 2:97083623-97083645 TCTTCTCGGTAGAAGGGAGAAGG - Exonic
936685747 2:114824123-114824145 TCTTATGTGTGGAATGAAGAGGG + Intronic
937153730 2:119703471-119703493 TATTATCAGTAGTAGTATGAAGG - Intergenic
937605195 2:123792080-123792102 TCTTATCTGTAGAATGCAGATGG - Intergenic
937714451 2:125015396-125015418 ACTTCACTGTAGTAGGGAGAAGG - Intergenic
937959779 2:127448361-127448383 TCTTATCTGTAGAAGAACAATGG - Intronic
938607555 2:132911590-132911612 TTTGAACTGTAGTAGGAAAAAGG - Intronic
939336845 2:140840318-140840340 TCTTGTATGTAGGAGGAAAAAGG - Intronic
939913357 2:148009860-148009882 TCTTATATGTAGCAGGTAGTAGG - Intronic
940317198 2:152337294-152337316 CCATATGTCTAGTAGGAAGAGGG - Intronic
943258214 2:185625019-185625041 CCTTATGTATGGTAGGAAGAAGG + Intergenic
943382801 2:187172081-187172103 TCTAATATGTAGTAGGGATATGG + Intergenic
943819068 2:192295702-192295724 TCATATCTGCAGAAGGAATAGGG + Intergenic
944128332 2:196318845-196318867 TCTTCTCAGGAGGAGGAAGACGG - Exonic
944737022 2:202576326-202576348 TCTTATCTTTTGTAGCAACATGG - Intergenic
945497486 2:210526485-210526507 TCTTATCTGTAAAAGAGAGAAGG + Intronic
945519945 2:210813935-210813957 TCTTATCTGTACTGGGAAGTTGG + Intergenic
947675340 2:231974023-231974045 TTTTAACTGTATTAGGAACATGG - Intronic
947920777 2:233870550-233870572 TCCTATATATAGTAGCAAGATGG + Intergenic
1170967506 20:21088155-21088177 TCTCATCTGAAGGAGGAAGGAGG - Intergenic
1171233045 20:23502543-23502565 TCTTATGTGCAGCAGGAAGCAGG - Intergenic
1171993643 20:31715777-31715799 AGGTATCTGTATTAGGAAGAGGG + Intronic
1173365731 20:42382867-42382889 TCCTATCAGTAGTAGGCAGCTGG - Intronic
1173756288 20:45519303-45519325 TCTCTTTTGTAGAAGGAAGAAGG + Intergenic
1174162460 20:48561363-48561385 TCTTATTTTTAGTAGAGAGAGGG - Intergenic
1174666772 20:52265386-52265408 TCCTCTCTGTAGGAGGAAGGTGG + Intergenic
1174726534 20:52868510-52868532 TCATATTTTTAGTAGGAACAGGG + Intergenic
1175486085 20:59347384-59347406 TCTTGTCTGAAGTATCAAGAGGG + Intergenic
1175871484 20:62211435-62211457 TCATATCTGTAGAACGAAGCAGG + Intergenic
1177506094 21:22018898-22018920 TATTCTCTGTGGTAGGAAAAGGG + Intergenic
1177839951 21:26224566-26224588 TATTCTCTGTAGCAGGAAAATGG + Intergenic
1178728328 21:35075671-35075693 TCTTATCTCTGGGAGGAAGCTGG - Intronic
1179039437 21:37789163-37789185 TTGCATCTCTAGTAGGAAGAAGG - Intronic
951604766 3:24421034-24421056 TCATATCTTTTGCAGGAAGATGG + Intronic
953277712 3:41519482-41519504 TCTCTTCTGTATGAGGAAGAAGG - Intronic
953366003 3:42345843-42345865 TCTTACCTTTAGTAGGATCAGGG - Intergenic
953921164 3:46952810-46952832 TCTCATCTGTGGTAGGAGAAAGG - Intronic
954336110 3:49918712-49918734 GCTCATCTTTAGTAAGAAGAGGG - Intronic
954566067 3:51601184-51601206 TTTTATCTTTAGTAGAAAGGAGG + Intronic
954942859 3:54391072-54391094 TCTTTTCTGTTTTGGGAAGACGG - Intronic
954989235 3:54825255-54825277 CCTTCTGTGTAGAAGGAAGAAGG - Intronic
955762050 3:62296734-62296756 ACTTATCTCTAGAAAGAAGAAGG + Exonic
956217125 3:66860198-66860220 TCTTATTTGGAGTGGGGAGATGG + Intergenic
958029461 3:88089715-88089737 TGGGATCTGTAGTAGGCAGAAGG - Intronic
958463590 3:94429511-94429533 TCTTATCTGTAGCAGAAAGCAGG - Intergenic
958696549 3:97535336-97535358 TCATATCTGTTATAGGAAAACGG + Intronic
960073115 3:113453940-113453962 TCTTATCTATAGTATTGAGAAGG - Exonic
960194068 3:114743420-114743442 AAATGTCTGTAGTAGGAAGAAGG + Intronic
960270991 3:115674524-115674546 TCTTGTCTTTAGTACTAAGATGG + Intronic
960905650 3:122598541-122598563 AGTTATCTGTGGGAGGAAGAGGG + Intronic
961135194 3:124503536-124503558 TTTTATCTGTGGTAGGCAGGTGG + Intronic
963366134 3:144336864-144336886 TCTTATGTAAAGTTGGAAGAAGG + Intergenic
964011639 3:151898978-151899000 TCTTATCTGTAGGAGTAATTGGG - Intergenic
966649496 3:182283454-182283476 TTTTATTTGTAGAATGAAGAAGG + Intergenic
967325533 3:188234932-188234954 TTTTGTCTGGAGTTGGAAGAAGG - Intronic
969511897 4:7622833-7622855 TTTCATCTGTGGTAGGAAGGAGG + Intronic
970654729 4:18218615-18218637 TCTTACCTGTAGTAGGCAGAGGG + Intergenic
971297595 4:25411662-25411684 TCTCATCTGTAAAATGAAGATGG + Intronic
972243423 4:37218992-37219014 TCTTATCTGTTATAAAAAGAGGG + Intergenic
974380408 4:61132577-61132599 TCTTTTCTCTAGTAGGAGAATGG - Intergenic
974588705 4:63917245-63917267 TAATATCTCAAGTAGGAAGACGG - Intergenic
974647552 4:64714764-64714786 TCTTATCTGTAGTAAGGCCAAGG + Intergenic
978047489 4:104149480-104149502 TCTGATCAGTAGTAAGAAGAAGG - Intergenic
978908224 4:114034946-114034968 TCATATCTGTAGTTCGAAGATGG - Intergenic
979711229 4:123781829-123781851 TCTGATCTTTAGGAGGAGGAAGG + Intergenic
979967108 4:127088505-127088527 TTTTTTTTGTAGTAGTAAGAGGG - Intergenic
980432843 4:132726912-132726934 TCTTAGCTCTGGAAGGAAGAGGG - Intergenic
980721657 4:136705262-136705284 TCTTCTCTGTAGGAAGAAGGTGG - Intergenic
980889667 4:138800901-138800923 TCAAACCTGTAGGAGGAAGACGG - Intergenic
980985780 4:139692756-139692778 TCTTATCTGAAAGAGGAAGAAGG - Intronic
986225151 5:5805358-5805380 TTTCATCTGTGGTAGAAAGAGGG + Intergenic
986835759 5:11635265-11635287 TGTTATCTTTAGAAAGAAGAAGG + Intronic
987178409 5:15340569-15340591 TCATATCTGTGGTTGGAAAATGG - Intergenic
987658558 5:20841326-20841348 TCATATCTGTTGCAGGAACATGG + Intergenic
987718667 5:21606707-21606729 TCTTATTTCTAATAGGAAGATGG - Intergenic
988765127 5:34364607-34364629 TCATATCTGTTGCAGGAACATGG - Intergenic
992936749 5:81715085-81715107 TCTTTGATGTAGTAGGAATATGG - Intronic
993628711 5:90257930-90257952 AATTATCTGTAGTACAAAGAAGG - Intergenic
994206908 5:97045556-97045578 TGTTAGATGTAGTAGGATGAAGG + Intergenic
994489101 5:100419111-100419133 AATTATCTGGAGTAGAAAGAGGG + Intergenic
995416826 5:111922133-111922155 TCTTATCCATAGTAGGACCATGG + Intronic
996950274 5:129118140-129118162 TATTGTCTGTGGTAGGCAGATGG - Intergenic
997185976 5:131882487-131882509 TCATATATGTTGTAGTAAGATGG - Intronic
997601915 5:135145329-135145351 TCAGATGTGTAGTTGGAAGAGGG + Intronic
999168942 5:149576413-149576435 TCTCATTTGTAGAAAGAAGATGG + Intronic
999655415 5:153805944-153805966 CCTTTTCTGCAGTTGGAAGATGG - Intronic
1002873980 6:1194373-1194395 TCTTATCTATTGATGGAAGATGG - Intergenic
1005224712 6:23628375-23628397 TCATATCTGTATTAGTAAGTAGG + Intergenic
1005439205 6:25847229-25847251 TCATATCTTTTGTAGGAAAATGG - Intronic
1007539424 6:42627319-42627341 TGTTATCTGTAGGAGCAAGTGGG + Intronic
1007998721 6:46336361-46336383 TCTTATCTCTAAGGGGAAGATGG + Intronic
1008679472 6:53856963-53856985 TCTTACCTGTGGTGGGAAGTGGG - Intronic
1009900314 6:69801181-69801203 TCTGATCTCTGGAAGGAAGATGG + Intergenic
1010753769 6:79643764-79643786 ACATATCTATAGGAGGAAGACGG - Intronic
1011166025 6:84447347-84447369 TCTTACCTGTAGAATGAACATGG + Intergenic
1011891603 6:92169328-92169350 TCTTATTTTCAGCAGGAAGAAGG - Intergenic
1012884511 6:104830619-104830641 TCTTATCTCTTGTTGGGAGAAGG - Intronic
1014194438 6:118536825-118536847 TCTTTTCTATATTAGGAAGCAGG - Intronic
1015288869 6:131515169-131515191 TCTTGTCTTTTGTAGGAACATGG - Intergenic
1015997135 6:139006799-139006821 GCTTGTCTGCAGTAGAAAGATGG + Intergenic
1016302946 6:142652226-142652248 TTTTTTTTGTAATAGGAAGATGG + Intergenic
1018622451 6:165743659-165743681 TGTTATCTGTCAGAGGAAGAGGG - Intronic
1020039316 7:4989337-4989359 GTTTATCTTAAGTAGGAAGAAGG - Intronic
1020155979 7:5725113-5725135 GTTTATCTTAAGTAGGAAGAAGG + Intronic
1020611871 7:10407836-10407858 TCTTATCAGAAGTAGGCAAAGGG - Intergenic
1020766718 7:12331192-12331214 TCTTATCTGTAGTAGGAAGAAGG + Exonic
1021849086 7:24790460-24790482 TTTTATGGGCAGTAGGAAGAAGG + Intergenic
1022241987 7:28521330-28521352 GATTATCTGAAGTTGGAAGAGGG + Intronic
1022344020 7:29496375-29496397 TCTTACCTTTTGTAGCAAGATGG - Intronic
1022633594 7:32109786-32109808 TCTTTTCTTTAGAGGGAAGAGGG + Intronic
1023121404 7:36912580-36912602 ACTTACCTGTAGTAGAAAGGAGG + Intronic
1023963024 7:44943510-44943532 CCATATGTGTAGTAGGGAGAGGG + Intergenic
1025278819 7:57610568-57610590 TCTTCTCTGTGGTTGGAAGGAGG + Intergenic
1026145940 7:67746820-67746842 TGAGATCTGTTGTAGGAAGAGGG + Intergenic
1027403353 7:77831956-77831978 TCTTATATGCAGAAGTAAGATGG + Intronic
1028534132 7:91872577-91872599 TTTTATCAATAGTAGGAATAAGG + Intronic
1029035398 7:97514712-97514734 ACTTATCAATAGTAGAAAGATGG - Intergenic
1029790300 7:102836430-102836452 TCTTATCTGTAGGGGGGAAATGG - Intronic
1030387752 7:108886357-108886379 TCTTTTCTATAGTAGGAAAAAGG - Intergenic
1031085211 7:117295801-117295823 TCTTATCTGTACAATGGAGAAGG + Intronic
1036599516 8:10247523-10247545 TCTTATGTTTAGAAGGAAAAAGG + Intronic
1037785475 8:21900443-21900465 TCTTATTTGTAGGTGGAAGCAGG + Intergenic
1039184459 8:34901000-34901022 TGTTAACAGTAGTAGGAAGTGGG + Intergenic
1041102358 8:54409233-54409255 TCTTATCTGTGAGATGAAGATGG + Intergenic
1041360950 8:57053528-57053550 CCTTATTTTTAGTGGGAAGATGG + Intergenic
1041782454 8:61592171-61592193 CCTTTACTGTAGTAGGAAGGAGG - Intronic
1044230166 8:89765654-89765676 TCCTAACTGCAGTAGGAAGAAGG - Intronic
1050182570 9:2936071-2936093 TCTTATTTGGAGTAGGGGGATGG - Intergenic
1051521747 9:17996977-17996999 TCTTATCTGAAATAGCAAGGAGG - Intergenic
1052318474 9:27141677-27141699 TCTCATCTTTAGTGGGAAGTTGG + Intronic
1055118753 9:72634305-72634327 TTTTATCTATAGGAGCAAGAGGG + Intronic
1055430670 9:76240026-76240048 TCTTATCTTTTATGGGAAGAAGG + Intronic
1055765003 9:79652742-79652764 TCTCATCTTTAATTGGAAGATGG - Exonic
1056489914 9:87095734-87095756 TCTTATCTGTATTAGGCATTGGG - Intergenic
1057376748 9:94531366-94531388 TATTTTCTGTAATAGGAAAATGG - Intergenic
1062521963 9:136961667-136961689 TGTTTTCTGCAGGAGGAAGAAGG + Intergenic
1185497962 X:572119-572141 TCGTATCCTTAGTAGAAAGAGGG - Intergenic
1187596869 X:20783010-20783032 TGTTATCAGTGGTAGGAAGGAGG - Intergenic
1188131284 X:26436301-26436323 TAATATCTGTGGTAGAAAGAGGG - Intergenic
1189003331 X:36968701-36968723 TCTGCTCTGTAGTAGTAAAAAGG + Intergenic
1189046306 X:37595184-37595206 TCTGCTCTGTAGTAGTAAAAAGG - Intronic
1189553753 X:42120126-42120148 TCTTATCTAAAGTAAGAAAATGG - Intergenic
1192627779 X:72748007-72748029 TTTTATCTGAAATAAGAAGAGGG - Intergenic
1192653929 X:72972802-72972824 TTTTATCTGAAATAAGAAGAGGG + Intergenic
1194551907 X:95311374-95311396 TCTTTCCTCAAGTAGGAAGATGG + Intergenic
1198301622 X:135339177-135339199 TCTTATCTGTTGAAGATAGAGGG - Intronic
1199384804 X:147211439-147211461 TCTTATAAGTAGAAGGAAGGTGG - Intergenic
1201853421 Y:18514770-18514792 TCTTATTTTTAGTAGAAAGGGGG - Intergenic
1201879900 Y:18805614-18805636 TCTTATTTTTAGTAGAAAGGGGG + Intronic
1201982372 Y:19922001-19922023 TCTTTCATGTAGTAGGAAAAAGG + Intergenic