ID: 1020766795

View in Genome Browser
Species Human (GRCh38)
Location 7:12332033-12332055
Sequence TCCCTACCTTCCCCAAAGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 261
Summary {0: 1, 1: 0, 2: 2, 3: 15, 4: 243}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1020766795_1020766808 30 Left 1020766795 7:12332033-12332055 CCCTCCTTTGGGGAAGGTAGGGA 0: 1
1: 0
2: 2
3: 15
4: 243
Right 1020766808 7:12332086-12332108 GTTCTATGGATACCCATGGATGG No data
1020766795_1020766803 -4 Left 1020766795 7:12332033-12332055 CCCTCCTTTGGGGAAGGTAGGGA 0: 1
1: 0
2: 2
3: 15
4: 243
Right 1020766803 7:12332052-12332074 GGGAAGAGGGGAGCAAGGGATGG No data
1020766795_1020766806 16 Left 1020766795 7:12332033-12332055 CCCTCCTTTGGGGAAGGTAGGGA 0: 1
1: 0
2: 2
3: 15
4: 243
Right 1020766806 7:12332072-12332094 TGGAGTTGGAGAAGGTTCTATGG 0: 1
1: 0
2: 0
3: 16
4: 220
1020766795_1020766802 -8 Left 1020766795 7:12332033-12332055 CCCTCCTTTGGGGAAGGTAGGGA 0: 1
1: 0
2: 2
3: 15
4: 243
Right 1020766802 7:12332048-12332070 GGTAGGGAAGAGGGGAGCAAGGG 0: 1
1: 0
2: 14
3: 163
4: 1875
1020766795_1020766807 26 Left 1020766795 7:12332033-12332055 CCCTCCTTTGGGGAAGGTAGGGA 0: 1
1: 0
2: 2
3: 15
4: 243
Right 1020766807 7:12332082-12332104 GAAGGTTCTATGGATACCCATGG No data
1020766795_1020766805 8 Left 1020766795 7:12332033-12332055 CCCTCCTTTGGGGAAGGTAGGGA 0: 1
1: 0
2: 2
3: 15
4: 243
Right 1020766805 7:12332064-12332086 GCAAGGGATGGAGTTGGAGAAGG 0: 1
1: 0
2: 6
3: 63
4: 712
1020766795_1020766801 -9 Left 1020766795 7:12332033-12332055 CCCTCCTTTGGGGAAGGTAGGGA 0: 1
1: 0
2: 2
3: 15
4: 243
Right 1020766801 7:12332047-12332069 AGGTAGGGAAGAGGGGAGCAAGG No data
1020766795_1020766804 2 Left 1020766795 7:12332033-12332055 CCCTCCTTTGGGGAAGGTAGGGA 0: 1
1: 0
2: 2
3: 15
4: 243
Right 1020766804 7:12332058-12332080 AGGGGAGCAAGGGATGGAGTTGG 0: 1
1: 0
2: 7
3: 71
4: 784

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1020766795 Original CRISPR TCCCTACCTTCCCCAAAGGA GGG (reversed) Intronic
902233845 1:15045165-15045187 ACCCTACCTTCCCCACAGGGTGG + Intronic
902500346 1:16906980-16907002 TCCCTGCTTTCTCCAAAAGAGGG + Intronic
904271475 1:29353157-29353179 TCCCCACCTCCCCCAAGAGAGGG - Intergenic
904754148 1:32758883-32758905 TCCCTTCCTTCCCAAACTGAGGG + Intronic
907887304 1:58605464-58605486 TCTCTTCCTCCCCCAAGGGATGG + Intergenic
910178617 1:84457747-84457769 TCCCAACCTTCAGCCAAGGAGGG + Intergenic
910228442 1:84961557-84961579 TCCCAACCTTCCCCAATGCTGGG - Intronic
910866783 1:91795970-91795992 TTCCTACCACCCCAAAAGGATGG + Intronic
912198111 1:107423899-107423921 TTCCTCTGTTCCCCAAAGGAAGG + Intronic
912285910 1:108368907-108368929 TCACTACCTTCTCCCAGGGAGGG - Intergenic
912855696 1:113167088-113167110 TTCCTCCCTCCTCCAAAGGAAGG - Intergenic
913135446 1:115884047-115884069 TCCCTTCCCTCCCAAAACGAGGG - Intergenic
913515646 1:119603438-119603460 TCCCTGCCTCCCCCATAGCATGG + Intergenic
913544199 1:119851292-119851314 TCACTACCTTCTCCCAAGGTGGG + Intergenic
914517216 1:148384175-148384197 TCCCTGCTTTCTCCAAAAGAGGG - Intergenic
915821608 1:159030506-159030528 TCTCCCCCTTCTCCAAAGGATGG + Intronic
916727048 1:167532834-167532856 TCCCTCACCTCCCCATAGGAGGG - Intronic
919991329 1:202710083-202710105 TTCCAAACTCCCCCAAAGGACGG + Intronic
920268735 1:204746711-204746733 GCCCTACCTTCCTCAAAGCAGGG - Intergenic
920986734 1:210897701-210897723 TCCCTACATTCCCCAAAGGCAGG - Intronic
921714148 1:218401339-218401361 TCCCTTCCGTCCCCAAAATATGG + Intronic
922793544 1:228324224-228324246 TCCCCACCCTCCCGAGAGGATGG - Intronic
1063410693 10:5834329-5834351 TCCCCACCTGCCCATAAGGAAGG - Intronic
1064585685 10:16837307-16837329 TCCCTCCCTTCCCCCGAGGCTGG - Intronic
1064803710 10:19107203-19107225 TCCCTACTTTCAGCAATGGACGG - Intronic
1066234778 10:33475249-33475271 TCCCTAACTTACCTAAAAGATGG + Intergenic
1069490591 10:68857326-68857348 TCCCTCCCCTCCTGAAAGGAGGG + Intronic
1069636716 10:69929600-69929622 TCCCCACCTGACCCAAAGAAGGG + Intronic
1071949328 10:90684751-90684773 TTCCTACCTCCGCCTAAGGAGGG - Intergenic
1072626615 10:97116417-97116439 TTCCCAGCTTCCCCAGAGGAGGG + Intronic
1076305626 10:129463971-129463993 TCCCTTCATTTCCCAAAGGTAGG + Intergenic
1077293978 11:1815459-1815481 TCCCTCCCTTCCCCAGGAGAAGG + Intergenic
1078191740 11:9096760-9096782 TCCTTCCCTTGCCCAAAAGAGGG + Intronic
1078988932 11:16625640-16625662 CCCATTCCTTCCCCAGAGGAAGG - Intronic
1079701657 11:23556014-23556036 TCCCTTTCTTCACCAAAGGCAGG + Intergenic
1080939592 11:36900607-36900629 TCCCTCCCTTTCCCTATGGATGG + Intergenic
1081861295 11:46334566-46334588 TCCCTTCCTCCCCCAAGTGATGG - Intronic
1083133917 11:60653859-60653881 ACCACATCTTCCCCAAAGGAAGG + Intergenic
1084666425 11:70578896-70578918 TCCCTGGCCTCCCCACAGGATGG + Intronic
1084893545 11:72249590-72249612 TTCCCAACTTCCCCAAAGGAAGG - Intergenic
1085232275 11:74982580-74982602 TTCCTCCCTTCCCCAAAGATGGG - Intergenic
1085347828 11:75779617-75779639 CCTCTGCCTTCCCCAAAGGTAGG + Intronic
1086120503 11:83300581-83300603 TCCCCCCCTTCCCCAGATGATGG + Intergenic
1086524672 11:87711363-87711385 TCCCTCCCCTTTCCAAAGGAAGG - Intergenic
1091176556 11:133563631-133563653 TCTCTCCCTTCCCCACAGAAAGG + Intergenic
1095814550 12:46407022-46407044 ACCCTATCTTCCCCAGTGGAGGG - Intergenic
1097022094 12:56027683-56027705 GCCCTACCTTGCCCAAGGGAAGG - Intronic
1101001467 12:100362081-100362103 GCCCCACTTGCCCCAAAGGAAGG - Intronic
1102663972 12:114554248-114554270 CCCTTTCCTTTCCCAAAGGATGG + Intergenic
1102987961 12:117294081-117294103 ATCCTACCTTGCCCACAGGAAGG + Intronic
1103322358 12:120099623-120099645 TGCCTACCTGCCCCAGGGGAGGG - Intronic
1103817683 12:123671626-123671648 CCCCCACCCTCCCCAAAAGAGGG - Intronic
1103944884 12:124520452-124520474 TCCAGACCTTCGCCAAAGGCTGG + Intronic
1109359287 13:61274972-61274994 TCTTAACCTTCCCCAAAGGGAGG + Intergenic
1110153329 13:72282361-72282383 TCCCTTTCTCCCCCAGAGGAAGG - Intergenic
1110897000 13:80766178-80766200 TCCATACCTTGTGCAAAGGAGGG - Intergenic
1112041692 13:95553367-95553389 CCCCTACGTTCCCCGAAGGCTGG + Intronic
1113383058 13:109821164-109821186 TCCCTACCTCATCCTAAGGAAGG + Intergenic
1113855957 13:113445596-113445618 CCCCTCCCCTCCCCAAAGGTGGG - Intronic
1117897773 14:60506445-60506467 TCACCGCCTTCCCCAAAAGAGGG + Intronic
1118005251 14:61559656-61559678 TCTCTATGTGCCCCAAAGGAAGG - Intronic
1121901467 14:97696999-97697021 TCCCTATCACCCCCAAAGGTGGG + Intergenic
1122172823 14:99890655-99890677 TCCCTACCTCTCCCAAGAGATGG + Intronic
1122604163 14:102937505-102937527 TCCCTCCCTCCCTCCAAGGATGG + Intronic
1122956014 14:105071677-105071699 CCCCTCCCTTCCCCAGAGCATGG + Intergenic
1125515268 15:40315606-40315628 GCCCTATCTCTCCCAAAGGATGG + Intergenic
1125956944 15:43797020-43797042 TCCCTATCCCCACCAAAGGATGG - Exonic
1127311684 15:57757421-57757443 TCCCTGCCGTCCCCAAATCAGGG + Intronic
1127573978 15:60272504-60272526 TCTCTCCCTTCCCCTAGGGATGG + Intergenic
1128078518 15:64842704-64842726 TCCCTGCCTTCCCCACCCGAGGG + Intronic
1128215017 15:65928523-65928545 TCCCTGTCTTCTCCACAGGATGG - Exonic
1128800896 15:70496200-70496222 ACCCTGCCTTCCCCACAGCAAGG - Intergenic
1129349914 15:74949789-74949811 ACCCTAGCTTCTCCAAAGGCAGG + Intergenic
1129642344 15:77393382-77393404 TCCCTTTCTTCTCAAAAGGAGGG - Intronic
1129827163 15:78641386-78641408 TCGCAACCTTCCCCCAAGGAAGG + Intronic
1130980840 15:88810952-88810974 TCTCTTCCTTCCCCAAGGGCAGG + Intronic
1132745900 16:1436213-1436235 CCCCCACCTTCCCCACTGGAGGG - Intronic
1133597708 16:7309296-7309318 TCCATAGGTTCCCCAAAGGGGGG - Intronic
1135413862 16:22254329-22254351 TCCCTGCCTTCCCCTCAGGCCGG + Intronic
1135623318 16:23974618-23974640 TCCATGACATCCCCAAAGGATGG - Intronic
1136662873 16:31780571-31780593 TCCCTAGATTCCCCACAGTAGGG - Intronic
1138455919 16:57120683-57120705 TCCCTGCCTTCCTCCTAGGAGGG + Intronic
1139853193 16:69962722-69962744 TCCCCACCATCCCCACAGGCTGG + Intronic
1139882164 16:70185630-70185652 TCCCCACCATCCCCACAGGCTGG + Intronic
1140370344 16:74409874-74409896 TCCCCACCATCCCCACAGGCTGG - Exonic
1140800017 16:78478475-78478497 TCCCTCCCTTCCACAAAACAGGG + Intronic
1140805883 16:78531936-78531958 TTCCCACCTTCCCAAAAGGGTGG + Intronic
1143573315 17:7775051-7775073 ACCCTGCCCTCCCAAAAGGAGGG + Intronic
1143729023 17:8869830-8869852 TCCCTACCATCACCAAGGCAAGG + Intergenic
1145167429 17:20625140-20625162 TCTCCCCCTTCCCCTAAGGATGG - Intergenic
1148229010 17:45919554-45919576 TCCCTACCTTCCCCCACTGCTGG + Intronic
1148260150 17:46175093-46175115 CCCCTCCCTGCCCCAAATGAGGG + Intronic
1150237578 17:63605374-63605396 TCCCTACCTGCCCCAGAGAAAGG - Intronic
1150423987 17:65062517-65062539 TCCCTTCCTTTCCCTATGGAAGG - Intergenic
1151468245 17:74301564-74301586 CCTCTTCCTTCCCCAGAGGAAGG - Intronic
1151772513 17:76173644-76173666 CCCCCAGCCTCCCCAAAGGAAGG + Intronic
1154145063 18:11860341-11860363 TCTCTAGCTTTCCAAAAGGAAGG + Intronic
1155171505 18:23270143-23270165 TCCCTAGCCTCCCCACAGCAGGG - Intronic
1155351349 18:24910457-24910479 TCCCTATCTTAGCCAGAGGAGGG + Intergenic
1155555902 18:27019114-27019136 TCCCTCCCTTTGCCAAATGAGGG + Intronic
1159792464 18:72799530-72799552 TCCCTACCTTGGTCAAAGGTAGG + Intronic
1165208153 19:34209432-34209454 TCCCTAACATCCTCACAGGATGG + Intronic
1166209733 19:41298585-41298607 TTCTTCCCTTCCCCAAACGAAGG + Intronic
926224934 2:10960935-10960957 TCCCTTCCTTCCCCCACGCAGGG + Intergenic
927420529 2:22926070-22926092 GCCCTCCCTTCTCCAAAGAAGGG + Intergenic
927458716 2:23279061-23279083 GGCCAACCTTCCCCAAATGAGGG + Intergenic
927866044 2:26588330-26588352 TCCTTGCCACCCCCAAAGGAGGG - Intronic
929279239 2:40060181-40060203 TCCCTCCCTTCCCCAAACTTGGG - Intergenic
930883707 2:56300200-56300222 TCCATTCCTTCCCCATAGGAGGG - Intronic
930924692 2:56802858-56802880 TCTCTGCCTTTCCCAAAGAAAGG + Intergenic
934545187 2:95208132-95208154 TCCCTACCTTCCAAAAGGGTCGG - Intronic
938942178 2:136178949-136178971 TCCCTCCCATGCCCAATGGATGG - Intergenic
940179966 2:150921180-150921202 TCCATACATTTCCCAGAGGAAGG - Intergenic
942222722 2:173787265-173787287 GCCCTACCTTCCCCAAAAGTAGG + Intergenic
944207842 2:197175566-197175588 TCCCTCCCTCCCCCAAAGAAAGG + Intronic
944385099 2:199155061-199155083 TGCCTCCCTTCCCCAAACCAGGG - Intergenic
948685301 2:239666162-239666184 TCACTCCCTTCCCCATAGGCTGG - Intergenic
1169230924 20:3888694-3888716 TCCCCTCCTTCGCCACAGGAGGG + Intergenic
1171779471 20:29405977-29405999 TCCCTTCCTTTCCTAAAGGCAGG - Intergenic
1173517689 20:43676661-43676683 TACCTATCTTCCCAAAAGAAAGG - Intronic
1174332496 20:49831247-49831269 TCCATACCAGCCTCAAAGGAAGG - Intronic
1175451839 20:59076029-59076051 TCTCCCCCTTCCCCAAAGAAGGG + Intergenic
1177463098 21:21438831-21438853 TCCGTACCTTCCCAAAATGTTGG - Intronic
1177884893 21:26735303-26735325 TTCCTCTCTTCCTCAAAGGAAGG - Intergenic
1180580266 22:16829008-16829030 TCACTATCAGCCCCAAAGGAGGG - Intergenic
1180606843 22:17065377-17065399 TGCCTATCCTCACCAAAGGATGG + Intergenic
1181049979 22:20233840-20233862 GCCCTCCCTTCCTCAAGGGATGG - Intergenic
1181128269 22:20714294-20714316 TCCCTGCCATCCCCCAATGAGGG + Intronic
1181635540 22:24172701-24172723 TACATCCCCTCCCCAAAGGAAGG - Intronic
1183492967 22:38126581-38126603 TCTGTCCCTTCCCCACAGGAAGG + Intronic
1183675503 22:39296982-39297004 TCCCCACCAGCCCCAAGGGAAGG - Intergenic
1183991586 22:41600543-41600565 TCCCTCCCTTACCCCAAGCAAGG - Exonic
1184368606 22:44068467-44068489 GCACTCACTTCCCCAAAGGAAGG - Intronic
949435987 3:4029819-4029841 TACCTACCTTACCAACAGGACGG + Intronic
949972665 3:9423861-9423883 TTTCTACCTTCCAAAAAGGAAGG - Intronic
950096121 3:10331688-10331710 TCCCTGCCTACCCTAAAGGTAGG + Intronic
950230395 3:11271059-11271081 CCCCCACCCTCCCCAAAGGCAGG - Intergenic
950502468 3:13373107-13373129 CCCCTTCCTGCCCCAAATGAAGG + Intronic
950968332 3:17162188-17162210 TGCCTACCCTCCCCACAGCATGG + Intronic
951197471 3:19840294-19840316 TCCCTGGCTTCCCCAAAGTCTGG + Intergenic
952342829 3:32459778-32459800 TCCCTACCTCCCCAAGAGCAAGG - Intronic
954305935 3:49725413-49725435 TCCCTCCCAGCCCCAAAGAATGG + Exonic
954727223 3:52623115-52623137 TCCCTTCCTTTCCCAAAAGTTGG + Intronic
955520329 3:59769366-59769388 TTCCCACCTTACCCAATGGAGGG - Intronic
956754763 3:72373695-72373717 TCCCATCCTCCTCCAAAGGATGG + Exonic
957085672 3:75674675-75674697 TCCCTTCCTTTCCTAAAGGCAGG + Intergenic
958566823 3:95822446-95822468 TGACTACTTTCCCCAAAAGAAGG - Intergenic
960026328 3:113014918-113014940 TCAATACCTCCCTCAAAGGATGG + Intronic
961111098 3:124283561-124283583 ACCATTCCTTCCCCACAGGAGGG + Intronic
962894327 3:139700312-139700334 ATCCCACCTTCCCCAAAGTATGG - Intergenic
963014463 3:140809018-140809040 TCTCTTCCTTCCCCTAGGGATGG + Intergenic
963726024 3:148922732-148922754 TCTCTCCCCTCCCCAAAGGTTGG - Intergenic
964299439 3:155271538-155271560 TCTCTCCCTTCCCCAAGGAATGG - Intergenic
964385320 3:156141147-156141169 TGCCTAGTTTCCCCAAATGATGG + Intronic
964504907 3:157388516-157388538 TGCCTACATTCTCCAGAGGAGGG - Intronic
967216009 3:187211038-187211060 TCCCCTCCTTCCCCAAAATAGGG - Intergenic
967996562 3:195171258-195171280 GCCCTACCCTTCCCACAGGAGGG + Intronic
968064841 3:195752957-195752979 TCCTCATCTTCCCCAAAGGTGGG + Intronic
968086989 3:195878246-195878268 TCCCTACCTTCCCTCGATGACGG + Exonic
969860044 4:10028513-10028535 TCCCTACCTGCATCACAGGAAGG + Intronic
970572140 4:17393442-17393464 TCCCTTCCTTCCAGAGAGGAGGG + Intergenic
971100337 4:23459394-23459416 TTCATATCTTCCCAAAAGGAAGG - Intergenic
971608270 4:28686601-28686623 TCCCTGCCCTCCCAACAGGAAGG + Intergenic
975348072 4:73316603-73316625 TCCCTACCATACTCAAGGGAAGG + Intergenic
975790440 4:77944094-77944116 TCCCCTCCTTCCCCTAGGGATGG + Intronic
976146280 4:82044750-82044772 TTTCTCCCTTTCCCAAAGGAAGG - Intergenic
978390541 4:108220577-108220599 TCCCTCCCTCCCCCACAGGTGGG - Intergenic
979584746 4:122403199-122403221 TCTCCCCCTTCCCCTAAGGATGG + Intronic
981442447 4:144798797-144798819 TCCCCTCCTTCCCCTAGGGATGG + Intergenic
984513147 4:180702977-180702999 TCCCTATCTACCTAAAAGGAGGG - Intergenic
984601041 4:181727161-181727183 CCTCTACCTTCCCCAGAGGTTGG + Intergenic
985100569 4:186454197-186454219 TGCCGACCTCCCCCACAGGAAGG - Intronic
989272011 5:39544729-39544751 TCCCTGCCTTCCCCAAGGGAGGG + Intergenic
989694311 5:44182159-44182181 TCTCTGCCTTCCCCTAGGGATGG + Intergenic
989727534 5:44604328-44604350 TCTCTCCCTTCCCCTAGGGATGG - Intergenic
991412101 5:66355821-66355843 TCTCTACCTTCCTGAATGGATGG - Intergenic
992087612 5:73291912-73291934 TGCCAACCTTCCTCAAAGAAAGG - Intergenic
992239528 5:74752839-74752861 TCTCCTCCTTCCCCTAAGGATGG - Intronic
992761001 5:79950844-79950866 TATCTACCTTCCCCAAGGGGTGG + Intergenic
993086793 5:83373080-83373102 TCCCTTTTTTCACCAAAGGAAGG - Intergenic
993569071 5:89513389-89513411 CACCTACCTACCCCAAAGCAAGG + Intergenic
994249668 5:97521105-97521127 TCCATACCTTTCCCACAGGTTGG - Intergenic
994354802 5:98783062-98783084 ACCCTACCTTTCCCAAGGAAGGG - Intronic
994414468 5:99450517-99450539 TTCTTATCTTCCCCAAATGATGG - Intergenic
996025370 5:118639224-118639246 TCTCTCCCTTCCCCTAGGGATGG - Intergenic
996608923 5:125356980-125357002 TCTCTCCCTTCCCCTAGGGATGG + Intergenic
997951193 5:138243899-138243921 TCCCTCTCTTCCCCTATGGAGGG + Intergenic
999032728 5:148312222-148312244 TTTCTATCTTCCCCAAAGGTGGG - Intergenic
999145869 5:149393382-149393404 TACCTGCCTTCCCCAACAGAGGG + Intronic
999149439 5:149417067-149417089 GCCCTATCTTCCCCAAGGGTAGG + Intergenic
999795839 5:154989047-154989069 TGCCTGCCTTCCCCAAGGAAAGG - Intergenic
1001580609 5:172795628-172795650 TCCCTAGCTTCCCCTAGGGATGG + Intergenic
1001801226 5:174545925-174545947 TCCATACCCTCCCCAAGAGAAGG + Intergenic
1002040136 5:176507384-176507406 TCCCTCTCTTCCCCAGAGGCAGG - Exonic
1002719811 5:181251526-181251548 CTCCTCCCTCCCCCAAAGGAAGG - Intergenic
1003692341 6:8366990-8367012 TATCTACCTTCCCCACTGGAGGG - Intergenic
1004479054 6:16001386-16001408 ACCAAAACTTCCCCAAAGGAGGG + Intergenic
1004836027 6:19532650-19532672 TGCCTTCCATCCCCAAAAGAGGG - Intergenic
1005120114 6:22380191-22380213 TCCTTACCTGCCCTCAAGGATGG + Intergenic
1005990623 6:30899579-30899601 CCCCACCCTTCCCCAAGGGATGG - Intronic
1006797475 6:36741051-36741073 TCCCCACCTTTCCCACAGCAGGG + Exonic
1007781364 6:44256825-44256847 TCCCCACCTGCCCCTAGGGAGGG + Exonic
1008723148 6:54382842-54382864 TTCCTCCTTTCCCAAAAGGAAGG + Intronic
1011794758 6:90940119-90940141 TCCCTGCTTGCCCCAAAGGCAGG - Intergenic
1011802756 6:91036419-91036441 ACCCCACCTTCTCCCAAGGATGG - Intergenic
1013154922 6:107484156-107484178 TCACAACCCTCCCAAAAGGATGG - Intergenic
1013983157 6:116157649-116157671 TCCCTGCCTTCCCCAAATTTGGG + Intronic
1014196239 6:118562943-118562965 ACCCTACCTTCCCCAAGAAAAGG + Intronic
1014532011 6:122569761-122569783 TCTCTCCCTTCCCCTAAGAATGG - Intronic
1014866525 6:126538175-126538197 TCCCCACCCTCCCCCAAGGCAGG + Intergenic
1015899950 6:138053898-138053920 TCTCCACCTTCCCCTAAGGATGG - Intergenic
1016684807 6:146869055-146869077 TCACTACCTCCCTCAGAGGATGG + Intergenic
1016910870 6:149197705-149197727 TCCCTATCTTGACCAAAAGAGGG - Intergenic
1016939681 6:149473899-149473921 ACCACACCTTCCCCAAAAGAAGG + Intronic
1018488854 6:164271462-164271484 TCCCTTCCTTAACAAAAGGAGGG + Intergenic
1018903994 6:168064678-168064700 TCCTTACCACCCCCAAAGGCAGG - Intronic
1020084916 7:5305123-5305145 TCCTTAGCTTCCCCAAGGAATGG + Exonic
1020766795 7:12332033-12332055 TCCCTACCTTCCCCAAAGGAGGG - Intronic
1021599963 7:22355746-22355768 ACCCTTCCCTACCCAAAGGAGGG + Intronic
1024157374 7:46639014-46639036 TCCCTTCCTTCTCCAAGGGGAGG - Intergenic
1025209371 7:57011989-57012011 TCCTTAGCTTCCCCAAGGAATGG - Intergenic
1025662574 7:63564865-63564887 TCCTTAGCTTCCCCAAGGAATGG + Intergenic
1026824841 7:73575071-73575093 TCACTAACTTACCCAAAGCAGGG - Intronic
1032184668 7:129714028-129714050 GCACTCCCTTCCCCAAAGAAAGG - Intronic
1035091486 7:156316541-156316563 TCCCTTCATTCCCCAAAGCCAGG + Intergenic
1037571948 8:20165301-20165323 TGCCTACCTTTCACACAGGAGGG - Intronic
1037637147 8:20710350-20710372 TCCTTGCCTTCCCCAAGGCAAGG - Intergenic
1038562201 8:28590221-28590243 TCCCTCCCTCCGCCAAAAGAGGG + Intergenic
1038881362 8:31617185-31617207 TCCCTACCAATCCCACAGGAAGG + Intergenic
1039546583 8:38415094-38415116 TCCCTTCCTTCCCCAAAGACTGG + Intronic
1042466634 8:69135875-69135897 TCTCTCCCTTCCCCTAAGGATGG + Intergenic
1042755301 8:72203810-72203832 TCGATACCGTCCCGAAAGGAGGG - Intergenic
1043655970 8:82665398-82665420 TCCCCACTTTCCCCAAAGTGGGG + Intergenic
1044319982 8:90791318-90791340 GCCCGACCTTCCCCAAAGGCGGG - Intronic
1045164166 8:99584175-99584197 TGCCTATCTTCTCCAAGGGAAGG + Intronic
1047915611 8:129580874-129580896 TCACTACATCTCCCAAAGGATGG - Intergenic
1049435227 8:142583395-142583417 TCCCTACAGTCCCCAAAGCCAGG - Intergenic
1051687609 9:19675065-19675087 TCTCTCCCTTCCCCTAGGGATGG + Intronic
1052048909 9:23823916-23823938 TCCCTCCCACCCCCAGAGGATGG + Intronic
1052371811 9:27674145-27674167 TCCCTAACTTTGCCAAAGGAGGG - Intergenic
1052685182 9:31746189-31746211 TCTCTCTCTTCCCCAAAGGTTGG - Intergenic
1055187043 9:73470204-73470226 TCTCCCCCTTCCCCTAAGGATGG + Intergenic
1056132295 9:83598572-83598594 TCACTACCTTGCCCAGATGAGGG - Intergenic
1056555892 9:87686744-87686766 GCCCTGCCTGCCCCAAGGGAAGG + Intronic
1057475802 9:95399919-95399941 TCTCTGCCTTCCCCTAGGGATGG - Intergenic
1057544246 9:96005471-96005493 TCCCTGACTTCCCAAAAGAAAGG - Intronic
1057711654 9:97451023-97451045 CCTCTACCTTCCCCAGAGGTTGG - Intronic
1058918737 9:109593077-109593099 CCTCTACCTTCCACAAAGAATGG + Intergenic
1059695929 9:116730513-116730535 TCCCTAGCCTCTGCAAAGGAAGG - Intronic
1061773382 9:132944690-132944712 TCCCCTCCTTCTCGAAAGGAAGG + Intergenic
1062277392 9:135737298-135737320 GCCCAACCATCCCCAGAGGACGG - Intronic
1062630835 9:137462419-137462441 AACCTACCTACCCCAGAGGATGG - Intronic
1186219682 X:7336243-7336265 CCCCCACCCGCCCCAAAGGAGGG + Intronic
1189631419 X:42957903-42957925 TGCCTACATTCCCCTAGGGAAGG + Intergenic
1190280736 X:48927778-48927800 TCTCTCCCCTCCCCAAAGGCTGG + Intronic
1191077198 X:56468240-56468262 TCTCCCCCTTCCCCTAAGGATGG + Intergenic
1191178966 X:57539003-57539025 CCTCTCCCTTCCCCAAAGGTCGG + Intergenic
1191782691 X:64885717-64885739 GCCCTACCTTCCTCATAGCAGGG - Intergenic
1193304833 X:79936237-79936259 TCCCTCCCTTCCCCAAACTCTGG + Intergenic
1198597417 X:138251685-138251707 TCTCTACCTTCCCTACAGTAAGG - Intergenic
1200770936 Y:7124834-7124856 TACCTATGTTCCCCAAAAGACGG + Intergenic