ID: 1020768092

View in Genome Browser
Species Human (GRCh38)
Location 7:12351458-12351480
Sequence TTTTTAGAAAGATCACCTAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 316
Summary {0: 1, 1: 0, 2: 1, 3: 27, 4: 287}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1020768092_1020768094 6 Left 1020768092 7:12351458-12351480 CCTTTAGGTGATCTTTCTAAAAA 0: 1
1: 0
2: 1
3: 27
4: 287
Right 1020768094 7:12351487-12351509 TACCTGAGGAATAAATATGTTGG 0: 1
1: 0
2: 0
3: 4
4: 215
1020768092_1020768096 29 Left 1020768092 7:12351458-12351480 CCTTTAGGTGATCTTTCTAAAAA 0: 1
1: 0
2: 1
3: 27
4: 287
Right 1020768096 7:12351510-12351532 TCTTCTAGAAAACAAGTAAGAGG 0: 1
1: 0
2: 0
3: 32
4: 332
1020768092_1020768093 -8 Left 1020768092 7:12351458-12351480 CCTTTAGGTGATCTTTCTAAAAA 0: 1
1: 0
2: 1
3: 27
4: 287
Right 1020768093 7:12351473-12351495 TCTAAAAATAAAAATACCTGAGG 0: 1
1: 1
2: 7
3: 98
4: 994

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1020768092 Original CRISPR TTTTTAGAAAGATCACCTAA AGG (reversed) Intronic
900583623 1:3421773-3421795 TTTGCAGAAAGTCCACCTAATGG - Intronic
905019657 1:34800066-34800088 TTTTTGGAAATACCACTTAAAGG + Intronic
906247558 1:44287804-44287826 ATTTTAGAAAAATCACATTAAGG + Intronic
906994390 1:50775627-50775649 GTTTTAGAAAAATCACCACAGGG + Intronic
907381721 1:54096278-54096300 TTTTTAGATGGATCACCTACTGG + Exonic
908586099 1:65571204-65571226 TTTTCAGAAAGAATAGCTAATGG + Intronic
908926192 1:69258071-69258093 TTTTAAGAAGGAACAACTAAAGG - Intergenic
910840312 1:91555019-91555041 TTTGCAGAAAGGTCACATAAGGG - Intergenic
911127224 1:94351798-94351820 TTTTTAGAAAGACTGCCTGAGGG - Intergenic
911644695 1:100325951-100325973 TTTTTAGAAAGAGTAACTTATGG + Intergenic
912119165 1:106448559-106448581 TTTTTTGAAAAATCACCATATGG + Intergenic
912397990 1:109362989-109363011 TTTTTAAAAGGATAACTTAAAGG - Intronic
913119255 1:115724703-115724725 TTTTTAAAAATATCAACTGAAGG - Intronic
914301638 1:146382437-146382459 TTTTTAAAAAAATAACGTAATGG - Intergenic
915502021 1:156325881-156325903 TTTTTAGAAAGATCAAGAGAAGG - Intronic
916950239 1:169772731-169772753 TATTTTCAAAGATAACCTAAGGG + Intronic
917325344 1:173825858-173825880 TTTTTAGAAAGACCACAAAAAGG + Intronic
917908965 1:179620336-179620358 TTTTTAGAATAATTTCCTAAAGG - Intronic
918709799 1:187712913-187712935 TTTTTAAAAAGATCCCCTATGGG - Intergenic
921226205 1:213022289-213022311 CTTTTATAGAGATCACCAAATGG - Intergenic
921244362 1:213221202-213221224 TTAATAGAAAGATCACATAATGG + Intronic
923656153 1:235918952-235918974 TTTTTAAAAAGACAACCTGATGG - Intergenic
924675926 1:246177970-246177992 TTTTTATAAACATCACTAAATGG - Intronic
924876737 1:248113955-248113977 TTTTTGGAAGAATTACCTAATGG - Intergenic
1064467488 10:15599090-15599112 TTTTTTTAAATCTCACCTAAAGG + Intronic
1065071543 10:22029859-22029881 TTTTCAAAAAGAGCTCCTAAAGG + Intergenic
1066031051 10:31425417-31425439 TTTTTAGAAACATTACCTCCTGG - Intronic
1068444826 10:57107727-57107749 TTTTTAAAAAGAGAAACTAAAGG + Intergenic
1068581663 10:58747685-58747707 TTTTTAGAAAGAGCATATAAAGG - Intronic
1068696749 10:59975903-59975925 TTTTTAGATATAACACCAAAAGG - Intergenic
1070411843 10:76149144-76149166 GTTCTGGAAAAATCACCTAAGGG - Intronic
1071443062 10:85720284-85720306 TTTTCAAAATTATCACCTAAAGG - Intronic
1071451854 10:85801318-85801340 TTTTTAGAAATATAAGCAAAAGG + Intronic
1071452059 10:85805036-85805058 TTTTTAGATATATGACCAAAAGG - Intronic
1072286427 10:93920211-93920233 TTTTTACAAAGCTTACCAAATGG + Intronic
1072893745 10:99347869-99347891 TTTATTGAAACATCACCTCAGGG + Intronic
1075192266 10:120320467-120320489 GTTTTAGAAAGATCATCCCAGGG - Intergenic
1075910301 10:126118933-126118955 TTTATAAAAAGATTTCCTAATGG - Intronic
1076022010 10:127081756-127081778 TTTTTAGAAAGAACTCGTAAGGG - Intronic
1077875012 11:6296690-6296712 TATTTATAGAGATCACCAAATGG - Intergenic
1078571966 11:12466660-12466682 TTTTTAGATACAACACCAAAAGG - Intronic
1078957216 11:16213026-16213048 TTTTAACAAAGATGACCTCAAGG - Intronic
1079157553 11:17962730-17962752 TATGGAGAAAGAACACCTAAGGG + Intronic
1079330111 11:19526139-19526161 TTTTTAAAAAAATCACCCCAGGG + Intronic
1079774461 11:24506617-24506639 TTTATAGAATGATAACCTACAGG + Intronic
1080692362 11:34568947-34568969 TTTTTAAAAAGAAGACCTATTGG + Intergenic
1081420590 11:42871762-42871784 TTTTTAGTAAGTTCTCCCAAAGG + Intergenic
1082852361 11:57776627-57776649 TATTTAGAAAGCCCAACTAAAGG - Intronic
1084437366 11:69151824-69151846 TTTTAAAAGAGATGACCTAATGG - Intergenic
1085191374 11:74627095-74627117 TCTTTTGAAATATCTCCTAAGGG - Intronic
1086852836 11:91831133-91831155 TTTTTAGCAAGAGCACCAAAGGG - Intergenic
1088347791 11:108848726-108848748 TTTTTAAAAAAATCCCCAAAAGG - Intronic
1089935192 11:122357475-122357497 TTTTTAGAAAAATAACATGATGG - Intergenic
1092118990 12:6030635-6030657 TTTTAAACAAGATCTCCTAAGGG + Intronic
1093116620 12:15219984-15220006 TGTTTAGAAAAATCACTTAAAGG + Intronic
1093222392 12:16438230-16438252 TTTGTAGAAAAATCACATTAAGG - Intronic
1093759054 12:22885599-22885621 TTTTTAGAAACAACACCAAAAGG - Intergenic
1096624564 12:52886369-52886391 TTATTAGAAGGATGAACTAAGGG + Intergenic
1097800768 12:63911491-63911513 TTTTCAGGGAGATCAGCTAAGGG - Intronic
1097900460 12:64867950-64867972 TTATTAGAAGGATGAACTAAGGG - Intronic
1098225591 12:68319183-68319205 TTTTTAAAATGCTCACTTAAGGG - Intronic
1098289000 12:68936683-68936705 TACTTAGAAAGATCACCTCTAGG - Intronic
1099264270 12:80424655-80424677 TTTTTAGAAAGCTGTCTTAATGG + Intronic
1099388848 12:82052781-82052803 ATTATAGAAAGATCATCTGATGG - Intergenic
1100140657 12:91614783-91614805 TTTTTATAAAGTACCCCTAAAGG - Intergenic
1100179218 12:92065917-92065939 TTTTTGTAAAGGTCACCAAAGGG + Intronic
1100724108 12:97390658-97390680 TTTTTAGAAAAATTATGTAATGG - Intergenic
1102693585 12:114780814-114780836 TTTTTACAGAGATCAACTGAGGG - Intergenic
1103636411 12:122310223-122310245 GTTTTAGTAAAATCATCTAATGG - Intronic
1105468016 13:20665382-20665404 TTTTAAGAAATATAACCAAAAGG - Intronic
1108715280 13:53072551-53072573 TTTTTAGAAAGTTAAACTAATGG - Intergenic
1109469447 13:62786225-62786247 TTTTTGGAAAGATCTCCTTCTGG - Intergenic
1109474919 13:62867633-62867655 TTTATAGAAAAATTACCAAATGG - Intergenic
1109673437 13:65639732-65639754 TTTTTAGAAAAAATGCCTAAGGG - Intergenic
1109763242 13:66859132-66859154 TTTTTATAAAGAACAACAAATGG + Intronic
1110345439 13:74442287-74442309 TTTTTAACAAGGTCACCAAAAGG - Intergenic
1110877149 13:80523936-80523958 TTATTAGATATATGACCTAATGG - Intergenic
1114373073 14:22111417-22111439 TATTTAGAAATATCACCTTTAGG - Intergenic
1114827366 14:26097561-26097583 TTTTTGCAAAAATCTCCTAAAGG - Intergenic
1115047849 14:29019707-29019729 TTCTTAGAAAAGTCACTTAAAGG - Intergenic
1115708519 14:36024376-36024398 TTTTTAGAAAGATCACTTCTAGG + Intergenic
1116083791 14:40208452-40208474 ATTTGAGAAAGATCCCCTAGTGG + Intergenic
1117331609 14:54718248-54718270 TTTTTAGAAAGGTCAACACAAGG + Intronic
1118062149 14:62151337-62151359 TTTTTAGAAAGACCAGTTAAAGG - Intergenic
1118994781 14:70825897-70825919 ATTTAAGAAATATCAACTAAGGG + Intergenic
1119053583 14:71395076-71395098 TTTTAAGAAAAATTTCCTAAGGG - Intronic
1119819996 14:77607133-77607155 TTTTAAAGAATATCACCTAAAGG + Intronic
1120346762 14:83300178-83300200 TATTTAGAAAGATCCACCAATGG - Intergenic
1123131424 14:105988662-105988684 TTTCTAGAAAGCTCATCCAAGGG - Intergenic
1125135618 15:36337655-36337677 TTTTTAGATAGATCACCAAAAGG - Intergenic
1125181716 15:36886788-36886810 TTTTTAAAAAGAGGACCTAGAGG + Intergenic
1126369151 15:47927295-47927317 TTTTTTCAAAGACCCCCTAAAGG + Intergenic
1126370145 15:47937639-47937661 TTTATAGAAATATATCCTAAGGG - Intergenic
1126834821 15:52650520-52650542 TTGTTACAAAGATCAGCAAAGGG + Intronic
1127571561 15:60248342-60248364 TTATTAGAAAGTTTACCAAAAGG - Intergenic
1128282480 15:66407933-66407955 TTTTGAGTAACATAACCTAAAGG + Intronic
1128437507 15:67668898-67668920 TTTTTAAAAAGTTCTCCTATTGG - Intronic
1130807654 15:87343051-87343073 TTTTTTCAGAGATAACCTAAGGG - Intergenic
1131270136 15:90942239-90942261 TTGTTAGAAAGATTTCCTAAAGG - Intronic
1131407704 15:92179466-92179488 TATTTAGAAAGATCATTCAATGG - Intergenic
1132325124 15:100962609-100962631 TGTTTAGAAAGAAAATCTAAAGG - Intronic
1132330903 15:101012064-101012086 CTTTTGGAAAAATCACCTGAAGG + Exonic
1133535840 16:6701616-6701638 TCTTTATAAAAATCACATAAAGG + Intronic
1134357392 16:13495957-13495979 TTTTTAGAAACACCAGCTAGTGG - Intergenic
1134614135 16:15636794-15636816 GTTTTAGTAAGATCCCCCAAAGG + Intronic
1138056855 16:53844007-53844029 TTTTTAAAAATATGACATAAAGG + Intronic
1139270715 16:65680347-65680369 ATTTTAGAAAGATCCCCCCAAGG + Intergenic
1141851256 16:86647608-86647630 TTTATGGAAAAAACACCTAAAGG + Intergenic
1143804924 17:9418393-9418415 TTGTTAGAACCATCTCCTAATGG - Intronic
1146673164 17:34756002-34756024 GTCTTAGAAAGATCACCTGTCGG - Intergenic
1146777486 17:35634357-35634379 TTTTTAGCAAGAATACCTATTGG + Intronic
1146866965 17:36345702-36345724 TATTTAGAAAGGTCCCCCAAGGG + Intronic
1146898587 17:36564986-36565008 TGTTATGTAAGATCACCTAAAGG + Intronic
1147069835 17:37946311-37946333 TATTTAGAAAGGTCCCCCAAGGG + Intergenic
1147081364 17:38025849-38025871 TATTTAGAAAGGTCCCCCAAGGG + Intronic
1147097308 17:38149806-38149828 TATTTAGAAAGGTCCCCCAAGGG + Intergenic
1149823762 17:59807530-59807552 CTTTTAGAAAGTTGAACTAAAGG + Intronic
1153700273 18:7685798-7685820 TCTCTAGAAAGAGCACCTGATGG + Intronic
1153746970 18:8189345-8189367 TTTTTGGAGAGATCAGCTCACGG + Intronic
1154007467 18:10545009-10545031 TTTTTAAAAAGATAACATACAGG + Intronic
1154041858 18:10863823-10863845 TTTTTGTAAAAATCACTTAATGG + Intronic
1154399100 18:14018259-14018281 TTTTTAAAAAAATAACCAAAAGG + Intergenic
1154404696 18:14078561-14078583 TTTTTAGGAAGACTACATAAGGG + Intronic
1155670669 18:28367227-28367249 ATTTTAGAAAGATCGCCACAAGG + Intergenic
1156000766 18:32381696-32381718 TTTTTAGAAAGATTAAGTGAAGG - Intronic
1156200956 18:34831247-34831269 ATTTTAGAAACATCATTTAAAGG + Intronic
1157022796 18:43806875-43806897 TTTTTAGAAAAGTAACATAAAGG + Intergenic
1157278348 18:46328521-46328543 TTTCTGGAAAGACCACCTCATGG + Intronic
1160546789 18:79662827-79662849 TTTTTAGAGAGTTCAAATAATGG - Intergenic
1161902920 19:7132921-7132943 TTTTTAGAAAGATAATATTATGG - Intronic
1162288488 19:9759870-9759892 TCTGCAGAAAGATCACCAAATGG - Exonic
1164373470 19:27662307-27662329 TTTTTAGTAAAATCTACTAAGGG - Intergenic
1168374876 19:55868444-55868466 TTTGTATAAGTATCACCTAAAGG - Intronic
924981681 2:228337-228359 TTTTTAGAAAGCTCACACAAGGG + Intronic
926440865 2:12887215-12887237 TTTTAGGAAAGAGCACCTATGGG - Intergenic
926896544 2:17696200-17696222 TTTTTAGAAACATGACATTAGGG + Intronic
927748881 2:25648536-25648558 TTTTTAAAAAGAGCTCCAAAAGG + Intronic
929728376 2:44457696-44457718 TTTTAAGAAATATGACTTAAGGG - Intronic
930779213 2:55206769-55206791 TGCTTAGAAACATCGCCTAAAGG + Intronic
931598115 2:63972995-63973017 TTTTCAGAGATATCACCGAAAGG + Intronic
931614963 2:64146112-64146134 ATTTTAGAAAGATCACTCTATGG + Intergenic
933136366 2:78740843-78740865 TATTTAGAAAGATCATTAAATGG - Intergenic
934877301 2:97936155-97936177 TTTTTAAAAATTTCCCCTAAAGG - Intronic
936842779 2:116793099-116793121 TTTATAGAAACATCACATAGGGG + Intergenic
936912818 2:117610485-117610507 GGTTTAGAGGGATCACCTAAGGG - Intergenic
937641179 2:124213248-124213270 TTTTTAAAAAGATGGCTTAATGG + Intronic
937748269 2:125441892-125441914 TTTCTAGATATATCACCAAATGG + Intergenic
938230943 2:129658497-129658519 TAATTTTAAAGATCACCTAAAGG - Intergenic
938774405 2:134529014-134529036 TTTTTATAAAGCTGAGCTAATGG - Intronic
939271994 2:139950955-139950977 TTCTTAGGAAGATCACATTAAGG - Intergenic
939694198 2:145304144-145304166 TTTTCAGAAATATTTCCTAAAGG + Intergenic
940984741 2:160041556-160041578 ATTTTAGAAAGATCATCAAGGGG + Intronic
941135912 2:161718229-161718251 TTTTTAAAAAAATCACCTCCTGG + Intronic
941890064 2:170571143-170571165 TTTTGAGCAAGAGCAACTAAAGG + Intronic
942180423 2:173375145-173375167 TTTTTCCAAAGATAATCTAATGG - Intergenic
942334391 2:174867071-174867093 TTTTTTTAAAGATTACTTAAGGG + Intronic
942470641 2:176256243-176256265 TTTTTAGAAATATTAAATAAGGG + Intergenic
942968309 2:181924662-181924684 TTTTTAAAAACCTCACTTAATGG - Intronic
943046243 2:182865823-182865845 GTTTTAGAAAGATCGCCTATTGG + Intronic
943050835 2:182911083-182911105 TCTTAGGAAAGAACACCTAATGG - Intronic
943212352 2:184983972-184983994 TTTTTAGACAGATGTTCTAAGGG - Intergenic
943819013 2:192294654-192294676 TATTTAAAAAAATCACATAAGGG - Intergenic
943899427 2:193413637-193413659 TTTGTAAAAAGATCACCAACTGG - Intergenic
944131257 2:196349886-196349908 TTTTTAGGAGGAACACCTAGGGG + Intronic
944770356 2:202908175-202908197 TTTTTATACATGTCACCTAATGG - Intronic
945922484 2:215769874-215769896 ATTCTTGAAAGATCTCCTAAAGG - Intergenic
946814016 2:223557399-223557421 ATTTTATAAATGTCACCTAATGG + Intergenic
946969080 2:225071922-225071944 TATTAAGAAAAATCACTTAAAGG - Intergenic
1171793573 20:29549230-29549252 TATTTATAAATATCACCTAATGG + Intergenic
1171854897 20:30335157-30335179 TATTTATAAATATCACCTAATGG - Intergenic
1172072247 20:32266672-32266694 TTTTTATAATAATCATCTAATGG + Intergenic
1174194772 20:48765414-48765436 CATTTAGAAAGATCAGATAAGGG + Intronic
1174733793 20:52944327-52944349 TTTTTACAAAGATAAAATAATGG + Intergenic
1182728669 22:32469759-32469781 TTTTTAGGAAGGTCACTAAAGGG + Intergenic
1184575231 22:45358580-45358602 TTTTTTAAAAGATTTCCTAATGG - Intronic
1184600122 22:45538546-45538568 TTTTTAAAAAGATAACATAAAGG - Intronic
949168633 3:971380-971402 TTTTTAAAAAGCTCATCTTAGGG - Intergenic
949848540 3:8397752-8397774 TTTCTAGAAAGTTCAGCCAATGG + Intergenic
952352911 3:32557924-32557946 ATTTTAGCATCATCACCTAAAGG - Intronic
955630755 3:60971706-60971728 TTTTTGGTAAGATTACCTCATGG + Intronic
955910624 3:63856092-63856114 TTTTTAGACAGATCCTCTATTGG - Intronic
958179102 3:90034917-90034939 TTTTTAAAAAAATCAACTACTGG + Intergenic
958799184 3:98736203-98736225 TTTTTAAGAAAATCTCCTAAGGG - Intronic
959011462 3:101081732-101081754 TTTTTAAAAAAATCACACAAAGG + Intergenic
959014703 3:101120786-101120808 TCTTTAGAAAGACCACTTGAAGG + Intergenic
959662952 3:108889653-108889675 TTTTTAGAAAGATGATGTTATGG + Intergenic
960008951 3:112812276-112812298 TTTTCAGAAAGATAACATTAAGG + Intronic
960445369 3:117742668-117742690 TTTTTAAAAAGATCAAATATAGG - Intergenic
960750716 3:120949574-120949596 TTTATACAAAAATCACCTCAAGG - Intronic
962687341 3:137860229-137860251 TTCTGGGAAAGATCACCTTACGG - Intergenic
965055223 3:163703170-163703192 TTTGTAAAAAGATAAACTAATGG - Intergenic
965999381 3:174928538-174928560 TTGTTACAAATATCACATAAGGG - Intronic
967592427 3:191294241-191294263 TATTTAGAATCATTACCTAAGGG + Intronic
969944322 4:10767493-10767515 TTTTTAGAAATATCATTTTATGG + Intergenic
970438548 4:16059390-16059412 TTTTGATAGATATCACCTAATGG - Intronic
971798885 4:31262522-31262544 TTTTTAGAAAGACCACTTTTGGG + Intergenic
972483405 4:39519479-39519501 GTTTTAGAAAGATAACTTGATGG - Intronic
973154982 4:46939681-46939703 TGTTTACAAAGATCACTTAGGGG - Intronic
973323759 4:48836286-48836308 TTTTTAAAAAGTTCGACTAAGGG + Intronic
973588006 4:52411501-52411523 TTTTCAGAGAGACCATCTAAAGG - Intergenic
974123908 4:57672256-57672278 ACTTTGCAAAGATCACCTAATGG + Intergenic
974393436 4:61304400-61304422 TTTTTAGTAGCATAACCTAAAGG - Intronic
975554795 4:75651112-75651134 TATTTAGAAACTTCAACTAAGGG + Intronic
976129401 4:81868923-81868945 TTTTGACAAAGATAATCTAACGG + Intronic
977752269 4:100623682-100623704 TTTGTAGAAATTTCACCTCATGG - Intronic
979208305 4:118069357-118069379 CATTTAAAAAAATCACCTAATGG - Intronic
981760072 4:148184663-148184685 TTTTTAAAAAAATCAACTGATGG + Intronic
982197003 4:152926622-152926644 TTTTTATTTAGATTACCTAAAGG - Intergenic
984441948 4:179782171-179782193 TTTTTAGATACAACACCAAAGGG - Intergenic
985392838 4:189509121-189509143 TTTTTTGAAAGAACTCATAAAGG + Intergenic
986048202 5:4061491-4061513 GTTTTAGACAGATGACTTAATGG - Intergenic
986947095 5:13035528-13035550 TTTTTAGAAACAACACCAAAAGG + Intergenic
987055902 5:14191273-14191295 TTCCTAGAAAAATCACTTAAAGG - Intronic
987285391 5:16451010-16451032 ATTTTAGAAAGACTACCTCAGGG - Intergenic
987330247 5:16850718-16850740 TTTTTAGAGCGATCACATTAAGG - Intronic
987942061 5:24551896-24551918 CTTTTAGAAAAATCATCTTAGGG + Intronic
988028784 5:25735368-25735390 TTTTTTTTAAGATTACCTAAGGG - Intergenic
988156048 5:27450182-27450204 TTTTTTCAAAGAACACATAATGG + Intergenic
990807324 5:59679612-59679634 GTATGAGAAAGATAACCTAATGG + Intronic
991981054 5:72231117-72231139 TTTTTAGAACGAACACAAAATGG + Intronic
992261414 5:74974251-74974273 TTTTCAGAATAATCAGCTAAGGG + Intergenic
992745242 5:79813500-79813522 TTTTTAAAAAGATATCCAAATGG - Intergenic
993417554 5:87653972-87653994 TTTTTAGAAAAATAAACCAATGG - Intergenic
993560898 5:89407134-89407156 TCTTTAGTAAGCTGACCTAATGG + Intergenic
995736192 5:115302545-115302567 TTTTTAGAATGATTATCTTAGGG + Intergenic
996328270 5:122300941-122300963 TTTTAAGATAAATCACCAAAAGG - Intergenic
996679671 5:126218101-126218123 TTTTTAAAAAGATAACATCAGGG - Intergenic
998056248 5:139080431-139080453 ATTTGAGAAAGATAGCCTAAAGG + Intronic
998866658 5:146511334-146511356 TATTGATAAAGATCACTTAATGG - Exonic
999953029 5:156670659-156670681 TTTTTAAAAATATCAGCCAAAGG + Intronic
1000147107 5:158464225-158464247 TGTATAGAAAGATCACTGAATGG + Intergenic
1003772493 6:9321857-9321879 TTGTGAGAAAGAGAACCTAATGG + Intergenic
1004153333 6:13142446-13142468 TTTTTAGATATGACACCTAAAGG - Intronic
1008853040 6:56047888-56047910 TTAGTATAAAGATCACATAAAGG - Intergenic
1008969323 6:57348225-57348247 TTTTTAAAAAGATAAACAAAAGG - Intronic
1009158299 6:60250050-60250072 TTTTTAAAAAGATAAACAAAAGG - Intergenic
1009443124 6:63706043-63706065 TTTGGAGAAAGATCATCTACAGG - Exonic
1009468299 6:64000915-64000937 GTCTGAGAAAGAGCACCTAAGGG - Intronic
1009484933 6:64209162-64209184 ATTTAAGAAATATCACCTTATGG - Intronic
1009593536 6:65706493-65706515 TTTTTAAAAAGAAAACGTAAAGG - Intronic
1009698208 6:67137974-67137996 TATTTAAAAATATAACCTAATGG + Intergenic
1009842506 6:69093957-69093979 TTTTTAAAAATATAACCTTAAGG + Intronic
1011391254 6:86856181-86856203 TTTTCAGATAGATCAGCTTAAGG + Intergenic
1013931473 6:115539352-115539374 TTTTTAAAAAGACCACCACAAGG - Intergenic
1013996481 6:116314785-116314807 TTTCTAGAATGTTCACATAATGG - Intronic
1014487880 6:122022826-122022848 TTTATAGAAAGACCAGCTCAAGG + Intergenic
1014794800 6:125712742-125712764 TTTTTAGAAAAATGACCAGAAGG - Intergenic
1015060302 6:128956351-128956373 TTTTTAAAAAAATTCCCTAAAGG - Intronic
1016153104 6:140768665-140768687 TTAAAAGAAAGATCACATAATGG - Intergenic
1016781231 6:147961354-147961376 TTCTTAGGAAGCTTACCTAATGG - Intergenic
1018429007 6:163709068-163709090 TTTTGAGAAAGATTAGCTATAGG - Intergenic
1018568196 6:165179678-165179700 TTTTTTAAAAAATTACCTAAAGG - Intergenic
1018884018 6:167917005-167917027 TTTTTATAAATATTACATAAAGG + Intronic
1019794878 7:3042305-3042327 TTTTTAAAAAAATCACATCAAGG + Intronic
1019965372 7:4494453-4494475 TTTCTGGAAATATCACATAAAGG - Intergenic
1020768092 7:12351458-12351480 TTTTTAGAAAGATCACCTAAAGG - Intronic
1025804349 7:64815845-64815867 CTTGAAGAAAGATCACCAAAGGG - Intronic
1026318904 7:69251967-69251989 ATTTTAGAATGATAACCCAAAGG + Intergenic
1026492861 7:70878008-70878030 TTTTTAGAGAGATTATATAAAGG - Intergenic
1027451473 7:78336291-78336313 TTTTTAAAAAGCTCTCCAAATGG + Intronic
1027869321 7:83686743-83686765 TTTACAGAAAAATCACTTAATGG - Intergenic
1030549379 7:110938757-110938779 TTTTTTTAATGGTCACCTAAGGG + Intronic
1031087449 7:117317073-117317095 TGTTTAGAGAGATCACATAGAGG + Intronic
1031762705 7:125734496-125734518 TTTTTACAAAGTCCACCTATGGG - Intergenic
1031843659 7:126777983-126778005 TTTTAAGAAAAATCATATAAAGG - Intronic
1032025734 7:128440807-128440829 ATTTTAGAAAAATTACATAATGG - Intergenic
1032599778 7:133280992-133281014 TTAATGGAAAGATCACCTCATGG - Intronic
1033026490 7:137778446-137778468 TTTTTTGAAAGATTACTTAGGGG + Intronic
1037386381 8:18347157-18347179 TTTTTATAAAGATCTTTTAAAGG + Intergenic
1038554476 8:28497593-28497615 AATTGAGAAAGATCATCTAAAGG - Intronic
1038994745 8:32909460-32909482 TATTTACAGAGATCACCAAATGG + Intergenic
1039216135 8:35273573-35273595 TGTTTAGAAAGCTCCCCAAAAGG + Intronic
1039290174 8:36086238-36086260 TTTCAAGAAATATCACCTAGTGG - Intergenic
1040938915 8:52812679-52812701 TTTCTAGCAAGATGACCTAAAGG - Intergenic
1041700436 8:60783094-60783116 TTTTTAAATTTATCACCTAATGG + Intronic
1041753970 8:61292477-61292499 TTTTAAGGAAGAGGACCTAAAGG - Intronic
1042019216 8:64352510-64352532 TTTTTAGAAAGAGAACTTGATGG + Intergenic
1042237438 8:66626998-66627020 TTTTGAGAAACATCACCTTTGGG + Intergenic
1042718472 8:71802061-71802083 TATTTAGAAAAAACACCTTAAGG + Intergenic
1044155573 8:88841795-88841817 ATTTTAGAAAAATCACTCAACGG - Intergenic
1045851217 8:106700501-106700523 TTTTTAGTAATAGCACATAAGGG + Intronic
1047161529 8:122386070-122386092 TTTTTAAAAAGCTCACCAAAAGG + Intergenic
1047205299 8:122798377-122798399 TTTTTAAAAATATCATTTAAAGG + Intronic
1047413590 8:124644870-124644892 TTCTTAGAAAAATGACTTAAGGG - Intronic
1049116800 8:140695700-140695722 ATCTCAGAAAGATCACCTTAGGG - Intronic
1049418659 8:142507112-142507134 TATTTACAAAGCTGACCTAAGGG + Intronic
1050946155 9:11520962-11520984 ATTTTATAAAGATCTCCTTACGG - Intergenic
1052098781 9:24417427-24417449 TTTTTAGAAGAATGACCAAAAGG + Intergenic
1053792721 9:41698441-41698463 TATTTATAAATATCACCTAATGG - Intergenic
1054152457 9:61616383-61616405 TATTTATAAATATCACCTAATGG + Intergenic
1054181134 9:61910462-61910484 TATTTATAAATATCACCTAATGG - Intergenic
1054472228 9:65547527-65547549 TATTTATAAATATCACCTAATGG + Intergenic
1054656457 9:67670680-67670702 TATTTATAAATATCACCTAATGG + Intergenic
1055084540 9:72300690-72300712 ATTTTAGTAAGATCATCTTATGG - Intergenic
1055844148 9:80540669-80540691 ATTTTAAAATGATCACATAATGG + Intergenic
1056543065 9:87590949-87590971 TTTTTAGAAATCTGACCTCATGG + Intronic
1056890075 9:90483485-90483507 TTTCTAATAACATCACCTAAGGG + Intergenic
1057884040 9:98815531-98815553 TTTTTGAAAACATCTCCTAAAGG - Intronic
1058014946 9:100020518-100020540 TTTTTGGAAAGATCATCTTCAGG + Intronic
1060145488 9:121248941-121248963 TTTTAAGAAAGATCATTTAGAGG + Intronic
1060521537 9:124296823-124296845 TTTTTGGAAACTTCACCTAGGGG - Intronic
1186050367 X:5586325-5586347 TTTTTTTAAAAATCACATAATGG - Intergenic
1187222079 X:17337877-17337899 TTTTTAAAAAATTCACCAAAGGG - Intergenic
1187755268 X:22518389-22518411 TCTATAGAAAGATCAGCTACTGG - Intergenic
1188641052 X:32505118-32505140 TTTTTAGATACACCACCAAAGGG + Intronic
1189051291 X:37648365-37648387 ATTTTAAAAAGATCACCAGATGG - Intronic
1191642119 X:63437204-63437226 TTTTGAGAAAGATCATATTAAGG + Intergenic
1192489510 X:71562699-71562721 TTTTTAAAAAAAGAACCTAAAGG - Intronic
1192950818 X:76014442-76014464 TTGTTAGAAAGTTCAACTAAAGG - Intergenic
1192951243 X:76019304-76019326 TTTATAGAAAAATCAACTCAAGG + Intergenic
1193332533 X:80251029-80251051 TTTTTAAAAAAATAACCTGATGG + Intergenic
1195086689 X:101420060-101420082 TTTTTAAAAAGACCACCAATTGG + Intronic
1195511122 X:105716431-105716453 TTTTTTGATAGACCACCTCAAGG + Intronic
1196744059 X:119052620-119052642 TTTTTAGATATAACACCAAAAGG - Intergenic
1197837146 X:130707030-130707052 TGTTTAGAATTATCACTTAATGG + Intronic
1199699908 X:150367387-150367409 CTTTTAAATTGATCACCTAAAGG + Intronic