ID: 1020771335

View in Genome Browser
Species Human (GRCh38)
Location 7:12398880-12398902
Sequence TAGGGACTACTGAAGGGGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 471
Summary {0: 1, 1: 0, 2: 11, 3: 71, 4: 388}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1020771327_1020771335 9 Left 1020771327 7:12398848-12398870 CCCACAGACATAAAGATGGGAAC 0: 1
1: 4
2: 19
3: 66
4: 260
Right 1020771335 7:12398880-12398902 TAGGGACTACTGAAGGGGGAAGG 0: 1
1: 0
2: 11
3: 71
4: 388
1020771328_1020771335 8 Left 1020771328 7:12398849-12398871 CCACAGACATAAAGATGGGAACA 0: 1
1: 7
2: 22
3: 69
4: 356
Right 1020771335 7:12398880-12398902 TAGGGACTACTGAAGGGGGAAGG 0: 1
1: 0
2: 11
3: 71
4: 388

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1020771335 Original CRISPR TAGGGACTACTGAAGGGGGA AGG Intronic
900687171 1:3955872-3955894 TAGGGGCTACTGAATGGGGAGGG + Intergenic
900743296 1:4343526-4343548 GAGGGGCTACTGCAGTGGGAGGG - Intergenic
902878346 1:19354428-19354450 AAGTAACTACAGAAGGGGGAGGG - Intronic
903007427 1:20308032-20308054 TCGGGACTACTGGTCGGGGAGGG - Intronic
906724542 1:48034604-48034626 TAGAGCTTACTGAAGGAGGATGG - Intergenic
907090383 1:51718958-51718980 TGGGGGCTGCTGAAGGGTGATGG - Intronic
908042400 1:60128621-60128643 TAAGGACTACTAGAGAGGGAAGG - Intergenic
908129024 1:61056289-61056311 GAGGGAATAATGATGGGGGAGGG - Intronic
908210171 1:61892354-61892376 TAAGTACTACTGAAGAGGAAAGG + Intronic
909005079 1:70266145-70266167 CAGGGACTACAGAAGGGGTGAGG - Intronic
909230231 1:73079811-73079833 TGGGGCCTACTGGAGGTGGAGGG - Intergenic
909875020 1:80790987-80791009 TAGGGACTACTTGAGGGTGGAGG + Intergenic
910081752 1:83350303-83350325 TGGGGCCTACTGAGGGTGGAAGG - Intergenic
910280434 1:85494680-85494702 TAGGGAATGGTGAATGGGGAGGG + Intronic
911649236 1:100368745-100368767 GAAGGACTACTGAAGTGGGGAGG - Intronic
911736831 1:101345888-101345910 TGAGGACTACTGGAGGGAGAGGG - Intergenic
912061254 1:105673976-105673998 AATAGACTACTAAAGGGGGAAGG - Intergenic
912269367 1:108193339-108193361 TAGGGACTCCAAAAGGGGGGAGG - Intronic
912761705 1:112373297-112373319 TGGAGACTACAGAAGGTGGAAGG + Intergenic
913178254 1:116295084-116295106 TACGGACTACTAAAAAGGGAGGG + Intergenic
913471351 1:119190462-119190484 TGGGGACTACTAGTGGGGGAAGG - Intergenic
915356007 1:155255457-155255479 CGGGGACTAGAGAAGGGGGATGG + Intronic
915980986 1:160419861-160419883 TAGGGAATATTAGAGGGGGATGG + Intronic
915989330 1:160497635-160497657 TGTGGACTACTAGAGGGGGAAGG - Intronic
916706841 1:167359353-167359375 TAGGGATTCCAAAAGGGGGAAGG - Intronic
916832105 1:168503670-168503692 TAGGAAAGACTGGAGGGGGAGGG - Intergenic
917484216 1:175440621-175440643 GAGGGACTATTGAAGTGAGAGGG + Intronic
918681178 1:187356024-187356046 CAGGGCCTACTGAAAGGTGAAGG + Intergenic
919161046 1:193831846-193831868 TGGGGACTACTAGATGGGGAAGG + Intergenic
919489937 1:198194449-198194471 TGGGGCCTACTGGAGGGTGAAGG - Intronic
921279641 1:213553164-213553186 TAGGGCCTACTTAAGGGGAGAGG - Intergenic
921948044 1:220901476-220901498 TAGATACTACTGAAAGGGGAGGG - Intergenic
922070827 1:222191582-222191604 TAGGGACTGCTGAAAGTGGAGGG - Intergenic
922152995 1:223021048-223021070 TAGGGACAACTGGAGAGGGCTGG + Intergenic
923161805 1:231321057-231321079 TGGGGACTACTAGAGGGGGAAGG - Intergenic
923714071 1:236410249-236410271 TAGGGACTCCAAAAGGGGGGAGG - Intronic
923930652 1:238692187-238692209 TGCGGACTACTAGAGGGGGAAGG + Intergenic
1064314612 10:14243640-14243662 TAGGGACTAGGGGAGGGGGATGG + Intronic
1064799744 10:19055835-19055857 TGGGGACTACTGAAGGGAAGAGG + Intronic
1066471494 10:35702225-35702247 TGGGGACTCTAGAAGGGGGAGGG - Intergenic
1066701117 10:38129427-38129449 CAGGGACTACTCAAGGTGGAGGG - Intergenic
1067484300 10:46633135-46633157 TGGGGACTACTAGAGGGAGAGGG - Intergenic
1067610460 10:47708511-47708533 TGGGGACTACTAGAGGGAGAGGG + Intergenic
1071625869 10:87168770-87168792 TGGGGACTACTAGAGGGAGAGGG + Intronic
1071913043 10:90257538-90257560 TAAGGACTGCTGAAGGAGGAAGG + Intergenic
1072509298 10:96102595-96102617 TGGGGACTACAGGAGTGGGAAGG + Intergenic
1073111120 10:101063556-101063578 TAGGGATTAGTGAAGGGGAGCGG + Intronic
1073934071 10:108609605-108609627 TAGAGTCTACTGAGGGTGGAGGG + Intergenic
1074543626 10:114385934-114385956 CAGGGACTCCTGAGGGGGGGCGG - Intronic
1074829460 10:117238686-117238708 TGGGGACTACTAAAGGGGAAAGG - Intergenic
1075423204 10:122321007-122321029 TAGGGACTACTAGAGTGGGGAGG - Intronic
1075541863 10:123320173-123320195 TGAGGACAACTGAACGGGGATGG - Intergenic
1075582430 10:123632141-123632163 TGGGGACTACTGGAGGGTGGGGG - Intergenic
1077792806 11:5460227-5460249 TGGGGCCTACTGGAGGGTGAAGG + Intronic
1077857143 11:6139308-6139330 TGCAGACTACTGATGGGGGAGGG + Intergenic
1078825665 11:14927833-14927855 TAGGAACTACTGAAAGGGAGAGG - Intronic
1080122005 11:28689296-28689318 CAGGGACTTCTGAACTGGGAAGG + Intergenic
1080368841 11:31610511-31610533 TGGGGAATACGGAGGGGGGAAGG - Intronic
1080480488 11:32644322-32644344 CAGGGCCTACTGAGGGTGGAGGG + Intronic
1080817187 11:35770060-35770082 TAGGGACTACTAGACGGGGAAGG - Intronic
1080959299 11:37139568-37139590 TGGGGACTACTAGAGGGAGAAGG + Intergenic
1081066196 11:38542886-38542908 TGGGGACTACTACAGGGGGTGGG - Intergenic
1081152850 11:39652991-39653013 TAGGGACTACTAGAGGGAGGAGG - Intergenic
1082107829 11:48239924-48239946 TAGGGACTACTTGAGGGGGGAGG - Intergenic
1082680437 11:56161920-56161942 TATGGACTACAGATGTGGGAAGG + Intergenic
1082812921 11:57489461-57489483 AAGGCACATCTGAAGGGGGAGGG - Intronic
1083126339 11:60570572-60570594 TCAGGACCACTGAATGGGGAAGG + Intergenic
1084344822 11:68539812-68539834 CAGGGACTGCTGAAGGTGGTGGG + Intronic
1084494572 11:69496582-69496604 TGGGGACAACTGAAGGGGCTTGG + Intergenic
1084838836 11:71828410-71828432 TGGGGACTACTAGAGGGGGAAGG + Intergenic
1085140442 11:74135955-74135977 TGGGGACTACTAGAGGGGTAAGG + Intronic
1085539149 11:77250242-77250264 TTGGGACTACTGAAGGAGGAAGG - Intronic
1086247824 11:84775730-84775752 TGGGTACTACTGGAGGGGGATGG + Intronic
1087260934 11:96011555-96011577 TGGGGACTCCAAAAGGGGGAGGG + Intronic
1087351544 11:97039931-97039953 TAGGGACTCCAAAAGGAGGAAGG + Intergenic
1087728993 11:101757505-101757527 TATGGAATACTGGAGGGAGAGGG - Intronic
1087908452 11:103725946-103725968 TGGGGCCTACTTAAGGGTGAAGG + Intergenic
1088187051 11:107182189-107182211 TGGGAACTACTAGAGGGGGAAGG + Intergenic
1090695024 11:129231704-129231726 TAGGGAATTCTGAATTGGGATGG - Intronic
1092399840 12:8165679-8165701 TGGGGACTACTAGAGGGGGAAGG - Intronic
1093097524 12:14988872-14988894 CGGGGACTACTAAACGGGGAGGG + Intergenic
1093135423 12:15444321-15444343 TGGGGACTACTCAAGGGGAGAGG + Intronic
1093345930 12:18038290-18038312 TAGGAGCTAGTGAAAGGGGAGGG - Intergenic
1094273410 12:28642170-28642192 AAGGGACTCCTGAAATGGGAGGG - Intergenic
1094384661 12:29881117-29881139 TAGGGACTCCAAAAGGGGGAAGG - Intergenic
1095662457 12:44753332-44753354 TAGGCAGTAGTCAAGGGGGAAGG - Intronic
1096031306 12:48417737-48417759 TGGGGACTACTAGAGGGAGAGGG - Intergenic
1096051077 12:48608051-48608073 TGAGGACTACTAGAGGGGGAAGG - Intergenic
1096205935 12:49721839-49721861 TGGGGACTACTAGAGGGGGTGGG - Intronic
1096348848 12:50877041-50877063 CAGGGACTACTAAAAGAGGATGG + Intronic
1100122229 12:91382251-91382273 TAGTGACTATTAAAGGGGGAAGG - Intergenic
1100637946 12:96453610-96453632 TGGGGACTCCAAAAGGGGGAGGG + Intergenic
1101174191 12:102131822-102131844 TGGGGCCTACTGAAGGGTGACGG + Intronic
1101977059 12:109368816-109368838 TGAGGACTGCTGGAGGGGGAAGG - Intronic
1103617202 12:122161842-122161864 TGGGGTTTACTGGAGGGGGAGGG - Intergenic
1103937825 12:124485919-124485941 GAGGGACTACAGCAAGGGGAGGG - Intronic
1104227585 12:126850842-126850864 TAGTGAGCACTGAAGGGGAAAGG + Intergenic
1104344037 12:127979704-127979726 TGGGGACTACTGGAGGTGGGAGG + Intergenic
1105843376 13:24274457-24274479 TGGGAACCACTGAAGGGGGATGG + Intronic
1105880322 13:24599983-24600005 TGTGGACTACTAGAGGGGGATGG - Intergenic
1105912773 13:24886519-24886541 TAGGGACTACTGGGAGTGGATGG + Intronic
1105919511 13:24948883-24948905 TGTGGACTACTAGAGGGGGATGG + Intergenic
1107351665 13:39520946-39520968 AAGGGACTACTGATGGGTCATGG + Intronic
1107485168 13:40819718-40819740 TGTGGACTACTAGAGGGGGATGG + Intergenic
1107814979 13:44236658-44236680 TGGAGACTACTGCAGGGGAATGG + Intergenic
1109291047 13:60475244-60475266 TGGGGACTGCTTAAGGGAGAAGG - Intronic
1109450388 13:62506823-62506845 TGGGGACTACTAGAAGGGGAAGG - Intergenic
1109500059 13:63223690-63223712 TGTGGACTACTAGAGGGGGAAGG - Intergenic
1110270865 13:73588813-73588835 TAGGGACTCCAAAAGGGGGAGGG + Intergenic
1110290603 13:73802623-73802645 TGGGAACTACTAGAGGGGGAGGG - Intronic
1111143266 13:84150085-84150107 TTGGGACTACTGTTGGGGGGAGG - Intergenic
1111313680 13:86522728-86522750 TGGGGCCTACTGGAGGGTGAAGG + Intergenic
1111710022 13:91799319-91799341 TAGGGACTACTAGAAGGAGAAGG + Intronic
1112695911 13:101947673-101947695 TGGGGACTACTAGAGGGGGTAGG + Intronic
1114822767 14:26041448-26041470 TAGGGCCCACTCAAGGAGGAAGG + Intergenic
1115239846 14:31243309-31243331 TGGGGACTACCAGAGGGGGAAGG - Intergenic
1115311136 14:31979631-31979653 TAGGGACTACTAGAGAGGGAGGG - Intergenic
1115653471 14:35420688-35420710 TGAGGACTACAGAAGGGAGAAGG + Intergenic
1115724486 14:36198456-36198478 TGGGGACTACTAGAAGGGGAAGG + Intergenic
1116252130 14:42499581-42499603 TGGGGACTCCAAAAGGGGGAAGG + Intergenic
1116358735 14:43965696-43965718 CAGGGACTACTGGAGGGTGGAGG - Intergenic
1117417841 14:55514055-55514077 TGGGGACTACTTGACGGGGAGGG - Intergenic
1117605811 14:57427654-57427676 TGGGGACTACTGGTGGGGGAGGG + Intergenic
1117766299 14:59086907-59086929 TGGGGACTACTGGGGGAGGAGGG + Intergenic
1117847715 14:59929912-59929934 TGGGGCCTACTGAAGGTGGAGGG + Intronic
1119192867 14:72695684-72695706 TGGGGACTCCAAAAGGGGGAAGG + Intronic
1120028968 14:79618344-79618366 TGGGGATTACTAGAGGGGGAGGG - Intronic
1120229534 14:81827900-81827922 TGGTGAGTGCTGAAGGGGGATGG + Intergenic
1121098366 14:91233498-91233520 AAGGGAAGACTGGAGGGGGAAGG - Exonic
1121177618 14:91902916-91902938 TGGGGACTACTAGAGGAGGAAGG + Intronic
1125312789 15:38398740-38398762 TAGAGACTATTGAAGAGGAAAGG - Intergenic
1125384305 15:39121127-39121149 AAGGGACTACTAGAGGTGGAAGG + Intergenic
1127065289 15:55230971-55230993 TAGGGACTCCAAAAGGGGGAAGG - Intronic
1129021475 15:72523474-72523496 TAGGGGTTAGTGAAGAGGGAGGG + Intronic
1129969720 15:79767663-79767685 TAGGAACTACTGTAAGGGAAGGG + Intergenic
1130356981 15:83142512-83142534 TAGGGCCTACTGGAGGGTAAAGG + Intronic
1131145418 15:90008228-90008250 TAGGCACTAGGGATGGGGGAAGG - Intronic
1132082896 15:98882703-98882725 TAGGGTATACAGAAGGGGCAAGG - Intronic
1134347624 16:13405627-13405649 TAGGGACTACTACAGTGAGAAGG - Intergenic
1134464827 16:14465986-14466008 TAGGGCCTACTTAAGGGTGGAGG + Intronic
1138921532 16:61535932-61535954 TGAGGACTACTGAAGGTAGAAGG - Intergenic
1139971935 16:70781750-70781772 TAGGGACTATGGAAGTGTGATGG + Intronic
1141276127 16:82589829-82589851 TAGGGACTACCTGAGGTGGAAGG - Intergenic
1141537745 16:84694648-84694670 TAGCGACTACTAGAGGGGGAAGG + Intergenic
1143337324 17:6181631-6181653 TGGGGACTACTAGAGGGGGCAGG - Intergenic
1143432049 17:6894620-6894642 TGGGGAGAAGTGAAGGGGGAGGG + Intronic
1143604818 17:7976757-7976779 CAGGGACTCCTGCAGGAGGAAGG + Intergenic
1144395312 17:14837500-14837522 TGGGCACTCCTGAAGGTGGATGG - Intergenic
1144396377 17:14847532-14847554 TAGGGACTTCTAGAAGGGGAAGG - Intergenic
1146049983 17:29542219-29542241 TAGAGACTACAGAAGGTGGGAGG + Intronic
1146240618 17:31219631-31219653 TAAGAACTACTTAGGGGGGAGGG - Intronic
1146390510 17:32417966-32417988 TGGGGACTCCTACAGGGGGAGGG - Intergenic
1146532171 17:33617486-33617508 CAGGGACTACTGGAGGGTGGAGG + Intronic
1146834689 17:36100812-36100834 CAGGGCCTACTTAAGGGTGAAGG - Intergenic
1146849297 17:36207997-36208019 CAGGGCCTACTTAAGGGTGAAGG - Intronic
1148018203 17:44537253-44537275 TGGGGACTTCTGAAGGGAAAGGG + Intergenic
1148998755 17:51735369-51735391 TGAGGACTACTGGAGGGGCAGGG + Intronic
1149810897 17:59670446-59670468 TGGGGCCTACTGAAGGGTGGAGG - Intronic
1149943052 17:60891806-60891828 TGGGGACTCCAAAAGGGGGAGGG - Intronic
1150175323 17:63048786-63048808 TAGGGCCTACTTGAGGGTGAAGG + Intronic
1150176067 17:63057586-63057608 TGGGGCCTACTTAAGGGTGAAGG - Intronic
1150704600 17:67475707-67475729 TAGGGAGGACTGGAAGGGGAGGG + Intronic
1151455688 17:74224529-74224551 TAGGGAAAACTCAAGGTGGAAGG + Intronic
1151968469 17:77444656-77444678 TAGGGAATACGGAGGGGAGAAGG + Intronic
1152557387 17:81060326-81060348 GAGGGACTGCTTAAGGGGTATGG - Intronic
1153106264 18:1531026-1531048 TGGGGACTACTAGATGGGGAAGG + Intergenic
1156032713 18:32731473-32731495 TGGGGTCTACTTGAGGGGGAGGG + Intronic
1156671536 18:39475568-39475590 TGGGGACTACTAAAGGGGAAAGG - Intergenic
1157213967 18:45766869-45766891 TGGGGACTCCTGAAGGGGGGAGG - Intergenic
1157428096 18:47601380-47601402 TAGGGACTAATGACAAGGGATGG - Intergenic
1157940565 18:51924245-51924267 TGGGGACTACTAGAGGGGAAAGG + Intergenic
1158709597 18:59825608-59825630 GAGGGACTACTAGATGGGGAGGG - Intergenic
1159410664 18:68071488-68071510 TGGGGACTACTGGGGGTGGAGGG + Intergenic
1161884347 19:6982273-6982295 TGGGGACTACTAGAGGGAGAGGG + Intergenic
1164511823 19:28903906-28903928 TAGGGAGTGCAGAAGGGTGATGG - Intergenic
1166201576 19:41240886-41240908 TTGGGATTAGTGAAGGGTGAGGG - Intronic
1166421216 19:42638750-42638772 TAGGAACTACTAAAGGGGGAGGG - Intronic
1167646847 19:50710654-50710676 AAGGGAGTGCTGAAGGGAGATGG - Intronic
925221343 2:2143949-2143971 TGGGGACTATTAGAGGGGGAGGG + Intronic
926183337 2:10666041-10666063 TGGGGATTACTGGATGGGGAAGG - Intronic
926385729 2:12334050-12334072 AAAGGAATACTGAAGGGTGAGGG - Intergenic
927016301 2:18965756-18965778 TGGGGACTACTGAAGGGGGGAGG - Intergenic
927402286 2:22726487-22726509 TAGGGACTACTAGAGTGGGGAGG - Intergenic
928240153 2:29578955-29578977 CATGGACTGCTGAATGGGGAGGG + Intronic
928468333 2:31546625-31546647 TGGGGACTAATAAAGTGGGAAGG + Intronic
928748601 2:34444949-34444971 GAGGGACTATTGCAGGTGGAAGG + Intergenic
929267665 2:39937434-39937456 TGGGGACTACTGGTGGAGGAAGG + Intergenic
929275062 2:40016027-40016049 TGGGGACTACTAGAGGGGGAAGG + Intergenic
929858850 2:45658096-45658118 AAGGGACTACTAAGGGGGTAAGG + Intronic
930563801 2:52994685-52994707 TGGGGTCTACTTGAGGGGGAAGG + Intergenic
931813317 2:65876014-65876036 TAGGGACTTCTAGAAGGGGAGGG - Intergenic
932103687 2:68923969-68923991 CAGGGACTCATGGAGGGGGATGG + Intergenic
932731243 2:74223405-74223427 TGGGGTCCACTGAAGGGGAATGG + Intronic
932880606 2:75498317-75498339 TAGGGACTATTAGAGGGGGAGGG + Intronic
933438728 2:82282598-82282620 TAGGGAGGCCAGAAGGGGGATGG + Intergenic
933771564 2:85747933-85747955 TAGATAATACTGAAGGGGAAGGG + Intergenic
934082139 2:88477873-88477895 TGGGGACTACTAGAGGAGGAAGG - Intergenic
934984228 2:98872447-98872469 TGGGGACTTCAAAAGGGGGAGGG + Intronic
935280320 2:101511735-101511757 TGGGGACTACAGAGGGAGGAGGG + Intergenic
935750288 2:106226639-106226661 TGGGGACTAGTAAAGGGGGGAGG + Intergenic
937446766 2:121965073-121965095 TAGGATCTACTTAAGGGGGAGGG + Intergenic
937461542 2:122092509-122092531 TAGGTACTACTGGAGGGTGTAGG - Intergenic
939432141 2:142124193-142124215 TGGGGTCTACTCAAGGGGGAGGG - Intronic
939940390 2:148342930-148342952 CAGGGACTACTAGAGGGGAAAGG - Intronic
940619550 2:156093926-156093948 GAGGGACTACTGCTGGGGGTAGG - Intergenic
941050611 2:160728791-160728813 TGGGGACTCCAAAAGGGGGAAGG + Intergenic
941514093 2:166450307-166450329 TGGGGACTACTAGAGGGGGAAGG + Intronic
942635666 2:178002071-178002093 TGGGGACTACTAGAGGGGGAAGG - Intronic
942902092 2:181133013-181133035 TAGGGACTCATGAGGGGGCAGGG - Intergenic
943057474 2:182999986-183000008 TGGGGACTCCAGAAGTGGGAAGG + Intronic
943184551 2:184590417-184590439 TGAGGACTACTAAAGGGGTAAGG - Intergenic
943900822 2:193433396-193433418 TGGGGACTACAAAATGGGGAAGG + Intergenic
944273748 2:197811968-197811990 TGGGGACTACTCGAAGGGGAAGG - Intronic
944947145 2:204701897-204701919 TGGGGACTTCTAGAGGGGGAAGG - Intronic
946549010 2:220779805-220779827 TGGGGACTACTGGAGTGGGAAGG + Intergenic
946652328 2:221906765-221906787 CAGGGCCTACTGAATGGGAAGGG + Intergenic
946784980 2:223234410-223234432 TAGGGACTCCAAAAGGAGGAAGG + Intergenic
947270925 2:228334113-228334135 TATGGACTATTAAAAGGGGAAGG - Intergenic
947599277 2:231435538-231435560 TGGGGACTACTAGATGGGGAAGG - Intergenic
947891490 2:233625777-233625799 TATGGACTACTAAAGGGGAGAGG + Intronic
948508416 2:238447032-238447054 GAGAGAATACTGAAGGGGCAAGG - Exonic
1169260497 20:4134829-4134851 GAGGGAGAACTGAAGGAGGAGGG + Intronic
1169996475 20:11563188-11563210 TGGGGACTACTAAAGGGAGGAGG + Intergenic
1170316350 20:15045203-15045225 TAGGGTCTTCTGCAGGGTGACGG - Intronic
1171299860 20:24050736-24050758 CAGGGACTAATCAAGGAGGATGG + Intergenic
1172937647 20:38631778-38631800 TAGAGGCTACTGCAGGGGGTGGG - Intronic
1173269260 20:41517047-41517069 TAGGGACATATGAAGGGTGACGG - Intronic
1174515437 20:51088653-51088675 TGGGGACTCCAAAAGGGGGAAGG - Intergenic
1175061835 20:56250395-56250417 TGGGGACAACTGAAGGGATATGG - Intergenic
1175182877 20:57160876-57160898 TAGGACCAACTGAAGGCGGAAGG - Intergenic
1175673365 20:60926078-60926100 TAGGGACTACTTGAGGGGGAAGG - Intergenic
1176741532 21:10608024-10608046 TGTGGACTACTAGAGGGGGATGG - Intergenic
1177121107 21:17138106-17138128 TGGGGACTACTAAAGGGAGGAGG + Intergenic
1177421509 21:20864244-20864266 TAGGGACTACTTGAGGGTGCAGG - Intergenic
1177567101 21:22838165-22838187 TGGGGACTACCAGAGGGGGAAGG + Intergenic
1178271774 21:31197074-31197096 TGGGGACTACCAGAGGGGGAAGG + Intronic
1178795139 21:35737049-35737071 TGGGGTCTACTTGAGGGGGAGGG + Intronic
1179226725 21:39460284-39460306 CAGAGACTACTGGAGGGGAAGGG - Intronic
1179266960 21:39812407-39812429 TTGGCACCACTGAAGGGGTAGGG + Intergenic
1180962369 22:19767661-19767683 TAGGGACAACTGCAGGTGGGAGG - Intronic
1181410240 22:22713352-22713374 TAGAGACTCCTGGAGGGGGCTGG - Intergenic
1181417794 22:22772735-22772757 TAGAGACTCCTGGAGGGGGCTGG - Intronic
1182272445 22:29163754-29163776 TGGGGACTACTAAGGGGGGAAGG + Intronic
949629502 3:5908161-5908183 TGGGGACTACTACAGGGGGAAGG - Intergenic
952121947 3:30255709-30255731 TGGGGTCTACTTGAGGGGGAGGG + Intergenic
952991944 3:38837765-38837787 GAGAGACTACTGCAGGGGTAGGG + Intergenic
953126229 3:40094048-40094070 TTGGGACATGTGAAGGGGGAGGG - Intronic
953423799 3:42775718-42775740 TAGGGACTAGGGCAGGAGGAGGG - Intronic
955126306 3:56115886-56115908 GAGGGATTACAGCAGGGGGAGGG - Intronic
955896042 3:63701058-63701080 TGGGGACTATTAGAGGGGGAAGG + Intergenic
956344434 3:68262436-68262458 GGTGGACTACTAAAGGGGGAAGG - Intronic
956626674 3:71273535-71273557 CAAGGAAGACTGAAGGGGGATGG - Intronic
956846088 3:73184131-73184153 CAGGGACTACTTGAGGTGGAGGG - Intergenic
957822547 3:85397705-85397727 TAGAGACTATTGAAGGCTGAGGG + Intronic
957988924 3:87606858-87606880 TTGGGACTTCTGGAGGGTGATGG + Intergenic
958026877 3:88059210-88059232 TAGGGAGGAGGGAAGGGGGAGGG + Intronic
958623844 3:96599833-96599855 TGGGGCCTACTGAAGGGTGGAGG + Intergenic
959424393 3:106168318-106168340 TGGGGACTACTAAAAGGGGGAGG + Intergenic
959667191 3:108935181-108935203 TGGGGACTACTGGTTGGGGAAGG + Intronic
959720531 3:109482148-109482170 TAGGGTTTATTGAAGGAGGAAGG + Intergenic
960304891 3:116049330-116049352 TAGAGACTACTGAAGATGAATGG - Intronic
960341612 3:116480990-116481012 TGGGGACTACTAGAGGGGGAAGG + Intronic
961724061 3:128914338-128914360 TAGGGCCTACTGGGGAGGGAGGG + Intronic
962080512 3:132134533-132134555 TCTGCACTACTGAAGGGGGAGGG + Intronic
962509941 3:136088253-136088275 TGGGGACTGCTGAAGTGGGTAGG - Intronic
962911026 3:139849683-139849705 TGGTGACTACTAAAGAGGGAAGG - Intergenic
963381991 3:144542110-144542132 TAGGGCCTACTTGAGGGTGAAGG + Intergenic
963384664 3:144575881-144575903 TGGGAACTACTAAAGGGGGAAGG + Intergenic
963641458 3:147865573-147865595 GAAGGGCTACTGATGGGGGAGGG + Intergenic
963733952 3:148998365-148998387 TTGTTACAACTGAAGGGGGAGGG + Intronic
964242347 3:154611273-154611295 TGGGGACTACTAGAGGGGGAAGG - Intergenic
964443360 3:156735311-156735333 TGGGGACTACTAGAGGGGGGAGG + Intergenic
964735586 3:159913848-159913870 TAGGGACAAGTGAATAGGGAAGG - Intergenic
964741600 3:159971838-159971860 TGGGGCCTACTGAAGGGTGGAGG + Intergenic
965326285 3:167308787-167308809 TGGGGCCTATTGAAGGGTGAGGG + Intronic
965392190 3:168118525-168118547 TGGGGTCTACTTAAGGGGGAGGG - Intergenic
965425802 3:168521076-168521098 TGGGGAGTACTGGAGGGAGAAGG - Intergenic
966131601 3:176647125-176647147 TAGGGACTGTTAAAGGGGGAAGG + Intergenic
966441531 3:179950347-179950369 TGGGGACTGCTGTAGGGTGAGGG + Intronic
966577149 3:181515017-181515039 TGGGGACTACTAAAGGGGGAAGG - Intergenic
966901098 3:184486054-184486076 TGGGGACCACTGAGTGGGGAGGG - Intronic
967280453 3:187817414-187817436 TGGGGACTACTAGAGGGGAAAGG - Intergenic
968982072 4:3855675-3855697 TAAGGACTCCTGAAGGAGGAAGG - Intergenic
969414311 4:7048739-7048761 CAGGGACTGGGGAAGGGGGAGGG - Intronic
969447468 4:7253458-7253480 AAGGCACTACAGAAGAGGGATGG + Intronic
969780257 4:9395894-9395916 TGGGGACTACTAGACGGGGAAGG + Intergenic
970563827 4:17311388-17311410 TGGGGACTACTAAAGGGGAAAGG + Intergenic
970647732 4:18142058-18142080 TAGGGAGCACTGAAGGAGGTTGG + Intergenic
971306793 4:25490070-25490092 TAGGGTGTACTTGAGGGGGATGG + Intergenic
971477184 4:27083517-27083539 TAGAGACTTCAGAAGGAGGATGG - Intergenic
972136196 4:35897492-35897514 TAGGGCCTATTGGAGGGTGAAGG + Intergenic
972824577 4:42742455-42742477 TAGGAACTACTGGTGGGGGAAGG + Intergenic
973221981 4:47737078-47737100 TTGGAACTACTCAAGGAGGAAGG + Intronic
973657495 4:53064275-53064297 TGGGGACTACTAGAGGGGGAGGG - Intronic
974090414 4:57304669-57304691 TGGGGACTACTAGAGAGGGAAGG - Intergenic
975024934 4:69535920-69535942 TAGGGACTTTTAAAAGGGGAGGG - Intergenic
975480703 4:74876916-74876938 TAAGGACTACTAGAGGGGGGAGG - Intergenic
975499242 4:75066967-75066989 CAGGGACTACTGGAGGGGGAGGG + Intergenic
976458106 4:85273656-85273678 CAGGGACTACTAGAAGGGGAAGG + Intergenic
976561155 4:86503027-86503049 GAGGGACTGCTGAAAGAGGATGG + Intronic
977030709 4:91878934-91878956 TGGGGACTACTAGAGGGGAAAGG - Intergenic
977191007 4:94000741-94000763 TAGGGACTACTAGAGGGGAAAGG - Intergenic
977920906 4:102641436-102641458 CTGAGACTACTGAAGGAGGAAGG + Intronic
978744784 4:112180190-112180212 TGGGGACTACTGGAGGGTGGAGG + Intronic
979211855 4:118114240-118114262 TAGGGAAAACTGAAGGATGAAGG - Intronic
979553804 4:122021735-122021757 TAGGGACTCTAAAAGGGGGAAGG + Intergenic
979719244 4:123879809-123879831 TGGGGACTACTGGAAGGGGTAGG + Intergenic
979737167 4:124101484-124101506 TAGGGACTACTAGAGGCGGAAGG - Intergenic
980155389 4:129098325-129098347 TGGGGACTACTAGAGGGGGGAGG - Intronic
980168566 4:129258535-129258557 TGGGGACTACTAGAGGGGAAAGG + Intergenic
980215754 4:129851002-129851024 TAGGGTCTACTTGAGGGTGAAGG + Intergenic
980390355 4:132137386-132137408 TGGGGATTGCTAAAGGGGGAAGG + Intergenic
980429378 4:132671609-132671631 TATGGACTACTAGAGGGGGAAGG + Intergenic
980622261 4:135323062-135323084 TGGGGACTACAAGAGGGGGAGGG + Intergenic
980670410 4:135997204-135997226 TAGGGACTACTGGAGGGGAGAGG + Intergenic
980862250 4:138513606-138513628 TATGGACCACTGAAGGGAGAAGG - Intergenic
980908030 4:138968077-138968099 TGGGGACTACTGGAGGGAGGAGG + Intergenic
982156359 4:152525463-152525485 TGGGGTCTACTTGAGGGGGAGGG - Intronic
982313480 4:154008944-154008966 TAGAAACTCCTGATGGGGGATGG - Intergenic
983281447 4:165685781-165685803 CAGGGACTACTGAAGGAAAAAGG + Intergenic
983324798 4:166239923-166239945 TGTGGACTACTAGAGGGGGAGGG + Intergenic
984897841 4:184557746-184557768 CAGGGACTACTAGAGGGGAAGGG + Intergenic
984944878 4:184963025-184963047 CAGGGAAAACTGAAGGAGGATGG - Intergenic
985205138 4:187527371-187527393 TGGGGACTAATAGAGGGGGAAGG + Intergenic
985862791 5:2487522-2487544 TAGGGACTCCTGCAGGGGGGAGG + Intergenic
986122178 5:4850335-4850357 TGGGGACTACTGGATGGGGGAGG - Intergenic
987458114 5:18171769-18171791 TGGAGACTACTGGAGGGGGAAGG + Intergenic
988405256 5:30816120-30816142 TGGGGACTACTAAAGGGGGAAGG - Intergenic
989216962 5:38914820-38914842 TGGGGACTACTAGAAGGGGAAGG + Intronic
989572249 5:42955453-42955475 TAGGGACTTTCGAAAGGGGAGGG + Intergenic
989715867 5:44462299-44462321 CAGGGACTACTTGAGGGTGAAGG - Intergenic
990042221 5:51389091-51389113 CAGGGACTTCTGCAAGGGGAAGG - Intronic
991068745 5:62453592-62453614 TATGGACTAGGGAAGGGGGTGGG + Intronic
991552825 5:67860906-67860928 TAGGGTCTACTTGAAGGGGAAGG + Intergenic
991594405 5:68288300-68288322 TAGGGATTTCGGGAGGGGGAGGG - Intronic
992778165 5:80105952-80105974 TAGGGATTGCTGAGGGGGAAGGG - Intergenic
993223361 5:85132873-85132895 TGGGGACTACTAGAGGGGGAAGG - Intergenic
993578302 5:89628878-89628900 TAGGGACTACTAGAAGGGGGAGG - Intergenic
994591511 5:101779146-101779168 TGGGGACTACTGGAGAGGGGAGG + Intergenic
994846476 5:104994797-104994819 TGGGGACTACAAGAGGGGGAAGG - Intergenic
994930323 5:106174636-106174658 GAGGGACTAGTGAATGGGTAAGG - Intergenic
995446703 5:112252685-112252707 TGGGGACTACTGGATGGGGGAGG + Intronic
996198472 5:120640125-120640147 TAGGAACTACTAGAGGGGGTAGG + Intronic
996215056 5:120856195-120856217 TAGGGAAGCCAGAAGGGGGATGG - Intergenic
996380439 5:122857563-122857585 TGGGGCCTACTGGAGGGTGAAGG - Intronic
996526178 5:124482234-124482256 TAGGGGTTGCTGAAGGTGGATGG + Intergenic
997917715 5:137944938-137944960 TGTGGACTACTAGAGGGGGAAGG + Intronic
999113945 5:149145145-149145167 TGGGCACTACTAGAGGGGGAAGG - Intronic
999377409 5:151096270-151096292 TAGAAACTACTGAAGGAGGGAGG - Intergenic
1000530826 5:162417643-162417665 TTGGGACTACTAAAGCAGGAGGG - Intergenic
1000900258 5:166904188-166904210 TAGGGAATACTGAATGCAGAAGG + Intergenic
1002440922 5:179264103-179264125 TAGGGACATCTGAAGGGGACAGG - Intronic
1003794213 6:9581736-9581758 AAGAGACTACTGCAGGTGGAAGG + Intergenic
1003990169 6:11478740-11478762 TGGGGCCTACTGAGGGTGGAGGG + Intergenic
1005653544 6:27908360-27908382 TAGGGACTACTAGAGTGGGTAGG + Intergenic
1005852953 6:29835887-29835909 TATGCACTGCTGAAGGGAGAAGG - Intergenic
1005876553 6:30014395-30014417 TATGCACTGCTGAAGGGAGAAGG - Intergenic
1006572727 6:35018694-35018716 TGGGGACTACTGGAGAGGGGAGG - Intronic
1006604173 6:35244288-35244310 TTGGGACTAGTGGAGGGGCAGGG - Intronic
1009640588 6:66330828-66330850 TGGGGCCTACTGGAGGAGGAGGG - Intergenic
1010743120 6:79530344-79530366 TAGGGACTATTAAAGGGTGAAGG + Intronic
1010819866 6:80401050-80401072 TGGGGCCTATTGAAGGGTGAAGG + Intergenic
1011013409 6:82727288-82727310 TAGGGACCACTGCTGGGGGGAGG + Intergenic
1011238672 6:85246826-85246848 TGGGGAGTACTGGAGGGGGAAGG - Intergenic
1011995901 6:93588054-93588076 TAGGGACTCCAAAAGGGGGAAGG + Intergenic
1012070857 6:94613935-94613957 TAGGGGCTACTAAAGGGGTAAGG + Intergenic
1012540140 6:100353083-100353105 TAGGGACTATTAGAGGGTGAAGG - Intergenic
1012599429 6:101076357-101076379 TGGGGACTACTAGAGGGGGAAGG + Intergenic
1013032616 6:106349795-106349817 TGGGGTCTACTTAAGTGGGAGGG - Intergenic
1013729845 6:113152453-113152475 TAGGGCCTACTGGAGGTTGAGGG + Intergenic
1015200973 6:130580545-130580567 TGGGGACTATTGGAGAGGGAGGG - Intergenic
1015281506 6:131439792-131439814 TGGGGACTCCAAAAGGGGGAAGG + Intergenic
1018362104 6:163081327-163081349 CAGGGACTACAGCAGGGGCATGG + Intronic
1018369725 6:163156554-163156576 TGGGGAGGACTGAAGTGGGAGGG - Intronic
1020771335 7:12398880-12398902 TAGGGACTACTGAAGGGGGAAGG + Intronic
1021093482 7:16509767-16509789 TGGGGCCTGGTGAAGGGGGAAGG - Intronic
1021213794 7:17890034-17890056 GAGGGTCTAGGGAAGGGGGAGGG + Intronic
1022198547 7:28093952-28093974 TATGGAATACTGAAGAGGGAGGG - Intronic
1024161209 7:46678375-46678397 TAAAGAATACTGAAGGGGGAAGG - Intronic
1026383821 7:69825718-69825740 TACGGACCACTGAAGGAGAAAGG - Intronic
1026597093 7:71742482-71742504 TGGGGACTACTAGAGGGGGAGGG - Intergenic
1027168252 7:75851500-75851522 TGGGGACTACTGGAGTGGGGAGG - Intronic
1027299238 7:76812588-76812610 TGGGGCCTACTGAGGGTGGAAGG - Intergenic
1028380061 7:90190202-90190224 TACGGGGTGCTGAAGGGGGATGG + Intronic
1028561595 7:92181840-92181862 TGGGGACTACTGGAGGTGGGAGG - Intergenic
1028817271 7:95160679-95160701 TGGGGACTACTAGAGGGGAAAGG - Intronic
1028840621 7:95426084-95426106 TGGGGACTACTAGAAGGGGAAGG + Intronic
1029116806 7:98241807-98241829 CAGGGCCTGCTGTAGGGGGATGG - Intronic
1029361137 7:100089276-100089298 TGGGGACTACTAAGGGTGGAGGG - Exonic
1029642885 7:101832250-101832272 CAGGGACCACTGAGGGGTGATGG + Intronic
1030760423 7:113343230-113343252 TGGGGACTACTGAATGGTGGAGG - Intergenic
1031242391 7:119263143-119263165 TGGGGACTACTAGAGGGGGGTGG - Intergenic
1031912282 7:127530848-127530870 TGGGGACTACTGGAGCAGGAAGG + Intergenic
1032778286 7:135138747-135138769 TAGGGCCTACTTGAGGGTGAAGG - Intronic
1034112445 7:148550718-148550740 TGGGGACTACTGGAGGGGAATGG - Intergenic
1034129942 7:148706453-148706475 TAGAGACTACTGAAATGAGAGGG + Intronic
1034198915 7:149268604-149268626 TGTGGACTACTACAGGGGGAAGG - Intronic
1035911103 8:3567256-3567278 TAGGAACTACTGGAGGGTGCAGG + Intronic
1036277680 8:7369874-7369896 TGGGAACTACTAGAGGGGGAAGG + Intronic
1036343844 8:7942048-7942070 TGGGGACTACTAGAGGGGGAAGG - Intronic
1036839185 8:12102815-12102837 TGGGGACTACTAGAGGGGGAAGG - Intergenic
1036860974 8:12349058-12349080 TGGGGACTACTAGAGGGGGAAGG - Intergenic
1037938049 8:22928298-22928320 GAGGGACTGCTGCAGGGGGTGGG + Intronic
1038661963 8:29505262-29505284 TGGGGACTACTAGATGGGGATGG - Intergenic
1040812838 8:51475781-51475803 TGGGGACTACTGGTGAGGGAAGG - Intronic
1041724759 8:61007811-61007833 TACAGACAACGGAAGGGGGAGGG + Intergenic
1041828733 8:62128395-62128417 TAGGGGATACTGTAGGGGGTAGG - Intergenic
1043132726 8:76481778-76481800 AAGGGACTAAAGAAGGGAGACGG - Intergenic
1043841120 8:85106030-85106052 TGGGGACTCCAAAAGGGGGAAGG + Intergenic
1046162936 8:110390705-110390727 TAGATACTATTGAATGGGGATGG - Intergenic
1047185976 8:122633851-122633873 TAGGTACCTCTGAAGAGGGATGG + Intergenic
1047233555 8:123018633-123018655 TAGGGTTTACTGAAGTGGGCTGG - Intronic
1047524258 8:125618998-125619020 TGGGGACTATTGCAGGGGGTGGG + Intergenic
1048079670 8:131111762-131111784 TAGGGACTACTAAAGGCAGGAGG - Intergenic
1048250014 8:132857348-132857370 TAGGGAGAACTGCATGGGGAAGG + Intergenic
1048526096 8:135204425-135204447 TAGGGACTACTGGAGTGGGGAGG + Intergenic
1048658082 8:136565029-136565051 TAGGACCTACTTGAGGGGGAAGG - Intergenic
1050621005 9:7451889-7451911 TGGGAACTACTAGAGGGGGAAGG - Intergenic
1050648785 9:7752712-7752734 GAGGGATTACTGAATGGGTATGG + Intergenic
1050674843 9:8040293-8040315 TGGGGACTACTAGAGGAGGAAGG - Intergenic
1051567966 9:18522130-18522152 TAGGGACTACTAGAGGGAGGAGG + Intronic
1052390290 9:27871477-27871499 TAGGGACTACTAGAGGGGGAAGG - Intergenic
1052995010 9:34547296-34547318 GAAGGACTTCTGAGGGGGGAGGG - Intergenic
1053108137 9:35431405-35431427 TGTGGACTACTAGAGGGGGAGGG + Intergenic
1054743988 9:68835720-68835742 TATTGACTATTGAAGGTGGAAGG + Intronic
1055589835 9:77800561-77800583 TGGGGACTGCTGTGGGGGGAGGG + Intronic
1055913903 9:81380697-81380719 TAGCAATTACTGAAGTGGGAAGG - Intergenic
1056556003 9:87688094-87688116 TGGGGACTACTAGAGGGGGTGGG - Intronic
1057967918 9:99522317-99522339 GAGGGACTACTAAATGGGGGAGG - Intergenic
1058102548 9:100933279-100933301 TAGGGACTACTAGAGCGGGGAGG - Intergenic
1058405297 9:104666774-104666796 TGGGGACTCCAAAAGGGGGAAGG + Intergenic
1058932351 9:109733525-109733547 TAAGGACTACGGAAGGGGAAAGG - Intronic
1059603357 9:115805928-115805950 TGGGGATTCCAGAAGGGGGAAGG + Intergenic
1059671143 9:116493612-116493634 GAGGGACTGCTGAAAGGAGAGGG - Intronic
1059702873 9:116792937-116792959 TGGGGACTACTGAGGGGGGAAGG + Intronic
1060706026 9:125802265-125802287 TAGGGACTACTAGAGAGGGGTGG - Intronic
1061387463 9:130299011-130299033 TGGGGACTCCTGCAGAGGGAAGG - Intronic
1203772735 EBV:57835-57857 TGGGGATTACTGGAGGGGGAAGG + Intergenic
1185908115 X:3956426-3956448 TGGGGGCTACTGGAGGGGGAGGG + Intergenic
1187683723 X:21795419-21795441 TAGGGCCTACTGGAGGGTGGAGG - Intergenic
1187891264 X:23937133-23937155 CAGGAACAACTGAAGGGAGAGGG + Intronic
1188341584 X:29008824-29008846 TGGGGACTATTGTGGGGGGAGGG - Intronic
1188676095 X:32941640-32941662 TAGGGATTACTAGAAGGGGAAGG + Intronic
1188877833 X:35453454-35453476 TGTGGACTACTAGAGGGGGAAGG - Intergenic
1189773390 X:44448321-44448343 TAGAGACTTCAGATGGGGGATGG - Intergenic
1190599191 X:52072000-52072022 TGGGGTCTCCTTAAGGGGGAGGG - Intergenic
1190609633 X:52182073-52182095 TGGGGTCTCCTTAAGGGGGAGGG + Intergenic
1191182278 X:57576430-57576452 TGGAGACTACTAGAGGGGGACGG + Intergenic
1191208755 X:57862615-57862637 TAGGGATTACTATAGCGGGAGGG + Intergenic
1191215284 X:57927079-57927101 TGGAGACTACTAGAGGGGGACGG - Intergenic
1191817320 X:65260403-65260425 TAGGGACTACTTGAGGGTGTAGG + Intergenic
1192724294 X:73731510-73731532 TAGGGACTCCAAAAGGGGCAAGG - Intergenic
1193103303 X:77640163-77640185 TATGAACTACTGGAGGGGGAGGG + Intronic
1193427853 X:81361625-81361647 TGGAGACTACAGAAGGGGGCAGG + Intergenic
1193932241 X:87567793-87567815 TGGGGACTTCTGGAGGGGGAAGG + Intronic
1194811397 X:98391320-98391342 TTGGGCCTACTTAAGGTGGAGGG - Intergenic
1195058855 X:101174651-101174673 TGGGGACTACTAGAGGGGGGAGG + Intergenic
1195420312 X:104667994-104668016 TTGGGAATAGTGACGGGGGATGG + Intronic
1195573128 X:106418956-106418978 TGGGAACTACTAAAGGGGAAAGG - Intergenic
1195575607 X:106446655-106446677 TGGGGACTACTGGAGGGGGGAGG + Intergenic
1195735372 X:108007476-108007498 TGGGGACTACTGGAGGGGAAAGG + Intergenic
1196028152 X:111064451-111064473 TAGGGACTACTAGAGGGGGAGGG - Intronic
1197256007 X:124263998-124264020 TGGGGACTACTGGAGGGGAGAGG - Intronic
1198842307 X:140871048-140871070 TGTGGACTACTAGAGGGGGAAGG - Intergenic
1199361470 X:146924420-146924442 TGGGGACTTCAGAAGGAGGAGGG - Intergenic
1199366801 X:146995855-146995877 TGTGGACTACTAGAGGGGGAGGG - Intergenic
1199414683 X:147567755-147567777 TGGGGACTACTAGAGGGGGGAGG - Intergenic
1201496018 Y:14592101-14592123 TAGGAGCTAGTGAAAGGGGAGGG + Intronic
1201772211 Y:17625810-17625832 AAGGGACAACTGCAGGGAGAAGG + Intergenic
1201829344 Y:18280176-18280198 AAGGGACAACTGCAGGGAGAAGG - Intergenic
1202599860 Y:26582250-26582272 TGTGGACTACTAGAGGGGGATGG - Intergenic