ID: 1020771812

View in Genome Browser
Species Human (GRCh38)
Location 7:12404445-12404467
Sequence AGAGCTCTTACAGTTGTCCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1020771806_1020771812 19 Left 1020771806 7:12404403-12404425 CCAAACCATGAGGTTTGTCACCT No data
Right 1020771812 7:12404445-12404467 AGAGCTCTTACAGTTGTCCCAGG No data
1020771807_1020771812 14 Left 1020771807 7:12404408-12404430 CCATGAGGTTTGTCACCTGTATT No data
Right 1020771812 7:12404445-12404467 AGAGCTCTTACAGTTGTCCCAGG No data
1020771808_1020771812 -1 Left 1020771808 7:12404423-12404445 CCTGTATTTGCCAGTGATTCCCA No data
Right 1020771812 7:12404445-12404467 AGAGCTCTTACAGTTGTCCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1020771812 Original CRISPR AGAGCTCTTACAGTTGTCCC AGG Intergenic
No off target data available for this crispr