ID: 1020778596

View in Genome Browser
Species Human (GRCh38)
Location 7:12489812-12489834
Sequence AGTGATGTGTAGAAGATGGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1020778593_1020778596 2 Left 1020778593 7:12489787-12489809 CCAATATTGCTGCATTTTGGACA No data
Right 1020778596 7:12489812-12489834 AGTGATGTGTAGAAGATGGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1020778596 Original CRISPR AGTGATGTGTAGAAGATGGG TGG Intergenic
No off target data available for this crispr