ID: 1020781194

View in Genome Browser
Species Human (GRCh38)
Location 7:12518656-12518678
Sequence GAGCACACCACCCAAGGACT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1020781194_1020781199 -7 Left 1020781194 7:12518656-12518678 CCAAGTCCTTGGGTGGTGTGCTC No data
Right 1020781199 7:12518672-12518694 TGTGCTCAGGCTTGGAGGTGTGG No data
1020781194_1020781200 4 Left 1020781194 7:12518656-12518678 CCAAGTCCTTGGGTGGTGTGCTC No data
Right 1020781200 7:12518683-12518705 TTGGAGGTGTGGTGCCAATTTGG No data
1020781194_1020781203 21 Left 1020781194 7:12518656-12518678 CCAAGTCCTTGGGTGGTGTGCTC No data
Right 1020781203 7:12518700-12518722 ATTTGGGAGTGTCTGTCCTCAGG No data
1020781194_1020781201 5 Left 1020781194 7:12518656-12518678 CCAAGTCCTTGGGTGGTGTGCTC No data
Right 1020781201 7:12518684-12518706 TGGAGGTGTGGTGCCAATTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1020781194 Original CRISPR GAGCACACCACCCAAGGACT TGG (reversed) Intergenic
No off target data available for this crispr