ID: 1020781196

View in Genome Browser
Species Human (GRCh38)
Location 7:12518662-12518684
Sequence AAGCCTGAGCACACCACCCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1020781196_1020781204 25 Left 1020781196 7:12518662-12518684 CCTTGGGTGGTGTGCTCAGGCTT No data
Right 1020781204 7:12518710-12518732 GTCTGTCCTCAGGCGCCTGATGG No data
1020781196_1020781201 -1 Left 1020781196 7:12518662-12518684 CCTTGGGTGGTGTGCTCAGGCTT No data
Right 1020781201 7:12518684-12518706 TGGAGGTGTGGTGCCAATTTGGG No data
1020781196_1020781200 -2 Left 1020781196 7:12518662-12518684 CCTTGGGTGGTGTGCTCAGGCTT No data
Right 1020781200 7:12518683-12518705 TTGGAGGTGTGGTGCCAATTTGG No data
1020781196_1020781203 15 Left 1020781196 7:12518662-12518684 CCTTGGGTGGTGTGCTCAGGCTT No data
Right 1020781203 7:12518700-12518722 ATTTGGGAGTGTCTGTCCTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1020781196 Original CRISPR AAGCCTGAGCACACCACCCA AGG (reversed) Intergenic
No off target data available for this crispr