ID: 1020781200

View in Genome Browser
Species Human (GRCh38)
Location 7:12518683-12518705
Sequence TTGGAGGTGTGGTGCCAATT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1020781196_1020781200 -2 Left 1020781196 7:12518662-12518684 CCTTGGGTGGTGTGCTCAGGCTT No data
Right 1020781200 7:12518683-12518705 TTGGAGGTGTGGTGCCAATTTGG No data
1020781194_1020781200 4 Left 1020781194 7:12518656-12518678 CCAAGTCCTTGGGTGGTGTGCTC No data
Right 1020781200 7:12518683-12518705 TTGGAGGTGTGGTGCCAATTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1020781200 Original CRISPR TTGGAGGTGTGGTGCCAATT TGG Intergenic
No off target data available for this crispr