ID: 1020781202

View in Genome Browser
Species Human (GRCh38)
Location 7:12518697-12518719
Sequence GAGGACAGACACTCCCAAAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1020781202_1020781206 -2 Left 1020781202 7:12518697-12518719 CCAATTTGGGAGTGTCTGTCCTC No data
Right 1020781206 7:12518718-12518740 TCAGGCGCCTGATGGTGTGCAGG No data
1020781202_1020781213 20 Left 1020781202 7:12518697-12518719 CCAATTTGGGAGTGTCTGTCCTC No data
Right 1020781213 7:12518740-12518762 GGGGATAGGCTGTAGTAGGCAGG No data
1020781202_1020781212 16 Left 1020781202 7:12518697-12518719 CCAATTTGGGAGTGTCTGTCCTC No data
Right 1020781212 7:12518736-12518758 GCAGGGGGATAGGCTGTAGTAGG No data
1020781202_1020781209 1 Left 1020781202 7:12518697-12518719 CCAATTTGGGAGTGTCTGTCCTC No data
Right 1020781209 7:12518721-12518743 GGCGCCTGATGGTGTGCAGGGGG No data
1020781202_1020781208 0 Left 1020781202 7:12518697-12518719 CCAATTTGGGAGTGTCTGTCCTC No data
Right 1020781208 7:12518720-12518742 AGGCGCCTGATGGTGTGCAGGGG No data
1020781202_1020781211 6 Left 1020781202 7:12518697-12518719 CCAATTTGGGAGTGTCTGTCCTC No data
Right 1020781211 7:12518726-12518748 CTGATGGTGTGCAGGGGGATAGG No data
1020781202_1020781204 -10 Left 1020781202 7:12518697-12518719 CCAATTTGGGAGTGTCTGTCCTC No data
Right 1020781204 7:12518710-12518732 GTCTGTCCTCAGGCGCCTGATGG No data
1020781202_1020781207 -1 Left 1020781202 7:12518697-12518719 CCAATTTGGGAGTGTCTGTCCTC No data
Right 1020781207 7:12518719-12518741 CAGGCGCCTGATGGTGTGCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1020781202 Original CRISPR GAGGACAGACACTCCCAAAT TGG (reversed) Intergenic
No off target data available for this crispr