ID: 1020781204

View in Genome Browser
Species Human (GRCh38)
Location 7:12518710-12518732
Sequence GTCTGTCCTCAGGCGCCTGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1020781202_1020781204 -10 Left 1020781202 7:12518697-12518719 CCAATTTGGGAGTGTCTGTCCTC No data
Right 1020781204 7:12518710-12518732 GTCTGTCCTCAGGCGCCTGATGG No data
1020781196_1020781204 25 Left 1020781196 7:12518662-12518684 CCTTGGGTGGTGTGCTCAGGCTT No data
Right 1020781204 7:12518710-12518732 GTCTGTCCTCAGGCGCCTGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1020781204 Original CRISPR GTCTGTCCTCAGGCGCCTGA TGG Intergenic
No off target data available for this crispr