ID: 1020781352

View in Genome Browser
Species Human (GRCh38)
Location 7:12519779-12519801
Sequence GGGCTACGGAGGCACAGCAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1020781352_1020781366 23 Left 1020781352 7:12519779-12519801 CCAATGCTGTGCCTCCGTAGCCC No data
Right 1020781366 7:12519825-12519847 AAACAGAGGTTCCCAGGATGTGG No data
1020781352_1020781363 9 Left 1020781352 7:12519779-12519801 CCAATGCTGTGCCTCCGTAGCCC No data
Right 1020781363 7:12519811-12519833 ACACCAGGGGATATAAACAGAGG No data
1020781352_1020781359 -5 Left 1020781352 7:12519779-12519801 CCAATGCTGTGCCTCCGTAGCCC No data
Right 1020781359 7:12519797-12519819 AGCCCTCTGGGTGGACACCAGGG No data
1020781352_1020781368 30 Left 1020781352 7:12519779-12519801 CCAATGCTGTGCCTCCGTAGCCC No data
Right 1020781368 7:12519832-12519854 GGTTCCCAGGATGTGGAGATGGG No data
1020781352_1020781360 -4 Left 1020781352 7:12519779-12519801 CCAATGCTGTGCCTCCGTAGCCC No data
Right 1020781360 7:12519798-12519820 GCCCTCTGGGTGGACACCAGGGG No data
1020781352_1020781365 17 Left 1020781352 7:12519779-12519801 CCAATGCTGTGCCTCCGTAGCCC No data
Right 1020781365 7:12519819-12519841 GGATATAAACAGAGGTTCCCAGG No data
1020781352_1020781367 29 Left 1020781352 7:12519779-12519801 CCAATGCTGTGCCTCCGTAGCCC No data
Right 1020781367 7:12519831-12519853 AGGTTCCCAGGATGTGGAGATGG No data
1020781352_1020781358 -6 Left 1020781352 7:12519779-12519801 CCAATGCTGTGCCTCCGTAGCCC No data
Right 1020781358 7:12519796-12519818 TAGCCCTCTGGGTGGACACCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1020781352 Original CRISPR GGGCTACGGAGGCACAGCAT TGG (reversed) Intergenic
No off target data available for this crispr