ID: 1020781647

View in Genome Browser
Species Human (GRCh38)
Location 7:12523662-12523684
Sequence CAAGTGGCCAACTCTGAGAT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1020781643_1020781647 12 Left 1020781643 7:12523627-12523649 CCTGATTGATTCTGATGAGGTTT No data
Right 1020781647 7:12523662-12523684 CAAGTGGCCAACTCTGAGATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1020781647 Original CRISPR CAAGTGGCCAACTCTGAGAT AGG Intergenic
No off target data available for this crispr