ID: 1020785463

View in Genome Browser
Species Human (GRCh38)
Location 7:12568022-12568044
Sequence CAACCTCAAGGGAAGGTGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1020785458_1020785463 1 Left 1020785458 7:12567998-12568020 CCACTTGATTTAGCTCTTGTAGA No data
Right 1020785463 7:12568022-12568044 CAACCTCAAGGGAAGGTGGAAGG No data
1020785457_1020785463 2 Left 1020785457 7:12567997-12568019 CCCACTTGATTTAGCTCTTGTAG No data
Right 1020785463 7:12568022-12568044 CAACCTCAAGGGAAGGTGGAAGG No data
1020785455_1020785463 25 Left 1020785455 7:12567974-12567996 CCTCAAGCCAGAGGACATCAGAG No data
Right 1020785463 7:12568022-12568044 CAACCTCAAGGGAAGGTGGAAGG No data
1020785456_1020785463 18 Left 1020785456 7:12567981-12568003 CCAGAGGACATCAGAGCCCACTT No data
Right 1020785463 7:12568022-12568044 CAACCTCAAGGGAAGGTGGAAGG No data
1020785454_1020785463 30 Left 1020785454 7:12567969-12567991 CCAAGCCTCAAGCCAGAGGACAT No data
Right 1020785463 7:12568022-12568044 CAACCTCAAGGGAAGGTGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1020785463 Original CRISPR CAACCTCAAGGGAAGGTGGA AGG Intergenic
No off target data available for this crispr