ID: 1020786788

View in Genome Browser
Species Human (GRCh38)
Location 7:12583670-12583692
Sequence CAGAGTTTCCACTATGGGCC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 356
Summary {0: 1, 1: 0, 2: 1, 3: 36, 4: 318}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1020786785_1020786788 30 Left 1020786785 7:12583617-12583639 CCACTGAAAGCAGTAGTATTCAC 0: 1
1: 0
2: 0
3: 7
4: 126
Right 1020786788 7:12583670-12583692 CAGAGTTTCCACTATGGGCCAGG 0: 1
1: 0
2: 1
3: 36
4: 318

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1020786788 Original CRISPR CAGAGTTTCCACTATGGGCC AGG Intronic
901749832 1:11399110-11399132 CAGAGTTTCCCCTGTTGTCCAGG - Intergenic
902198648 1:14817314-14817336 CAGAGGGCACACTATGGGCCAGG - Intronic
903423283 1:23234196-23234218 CAGAGTTTCCCATGTTGGCCAGG + Intergenic
903602671 1:24553975-24553997 CAGAGTGTTCACTATAGGCCAGG - Intergenic
904053800 1:27657064-27657086 CTGAGATTCCATTTTGGGCCAGG + Intergenic
904330308 1:29754249-29754271 CAGAGTTCCCACTGAGTGCCAGG + Intergenic
904373957 1:30068051-30068073 CTGAGTGTCCACCATGTGCCAGG - Intergenic
904539854 1:31225517-31225539 CAGGGTTTGCACTCTTGGCCAGG + Intronic
904840771 1:33370522-33370544 CAGAGTTCACACTCTGGGCCCGG + Exonic
906272322 1:44489513-44489535 TTGAGTTCCCACTATGTGCCAGG + Intronic
906645181 1:47469763-47469785 CTGAGTACCCACTATGTGCCAGG + Intergenic
906983099 1:50652869-50652891 CTGAGTGTCTACTATGAGCCAGG + Intronic
908163024 1:61430242-61430264 CAGAGTACCCACTATGTGCTGGG - Intronic
908649476 1:66315891-66315913 CAGAGTTTTCACTGAGGGCTTGG + Intronic
908857000 1:68441903-68441925 CTGAGCTTTCACTATGTGCCAGG + Intronic
910078857 1:83315004-83315026 CTGAGTATTCACTATGTGCCAGG - Intergenic
911063946 1:93770923-93770945 CAGAGCTTCCACTGAGAGCCGGG - Intronic
912210031 1:107547135-107547157 CTGAGTGTCCACTATGTGCAAGG + Intergenic
912343166 1:108937399-108937421 CAGAGTTTCTGCTATGGTGCTGG - Exonic
912410379 1:109477074-109477096 CAGAGGTTCCACCATGGGGGTGG - Intronic
912554958 1:110509171-110509193 CTGGGTTTCTACTGTGGGCCAGG + Intergenic
912688695 1:111787219-111787241 TAGAGTATCTACTATGTGCCAGG + Intronic
913270453 1:117087911-117087933 TTGAGTATCCACTATGGGTCAGG + Intronic
913295918 1:117320353-117320375 CAGAGTTTTTACCATGTGCCAGG - Intergenic
913432859 1:118814353-118814375 CTGAGTCTCTACTATGTGCCAGG + Intergenic
914672299 1:149880484-149880506 AAGAGTAGCCACTATTGGCCGGG + Intronic
915956686 1:160226032-160226054 CAGAGTTTCATCTGTTGGCCAGG + Intronic
917636489 1:176942163-176942185 CATAGATCCCACTATGGGTCAGG + Intronic
917793726 1:178516704-178516726 CACAGTTTCCAGTATGGTACTGG - Intronic
918557203 1:185817015-185817037 CTGAGCTTCCACTATGTGCCAGG - Intronic
918619296 1:186583964-186583986 AAGAGTTTGCACTGTGTGCCTGG + Intergenic
923090742 1:230739367-230739389 CACAATTTCCACTATGGGGCGGG + Intergenic
923378548 1:233391428-233391450 CAGAGATTCCACTCTGGGAGAGG - Intergenic
924093158 1:240523116-240523138 CAGAGTTTTCACTCTTGCCCAGG + Intronic
924778155 1:247125467-247125489 CAGAGTTTCCTCTTTCGCCCAGG + Intronic
1063022286 10:2141509-2141531 CAGAGTTTCCTCTATCACCCAGG - Intergenic
1063935395 10:11072439-11072461 TAGAGGTTCCACTATGGTCATGG - Intronic
1064046078 10:12016829-12016851 ACGAGTTTTCACCATGGGCCAGG - Intronic
1064143886 10:12812318-12812340 CAGAGCTCCCACCATGGGCCGGG + Intronic
1064267364 10:13835954-13835976 GAGAGTGTCTACTATGAGCCTGG + Intronic
1064569166 10:16674493-16674515 CAGAGAGTCCACTAGGTGCCAGG + Intronic
1064757681 10:18586740-18586762 CAAAGTTTCCACTATGTGGAAGG + Intronic
1065774343 10:29105560-29105582 CAGAGTGTCTACTATGTGTCAGG - Intergenic
1066066855 10:31767763-31767785 CAAATTTTCTGCTATGGGCCAGG - Intergenic
1066094844 10:32062229-32062251 TTGAGTTCCCACTATGGTCCAGG + Intergenic
1066204437 10:33173731-33173753 CACAATTTCTACTATGGGTCTGG - Intergenic
1067609161 10:47694712-47694734 CAAATTTTTCAGTATGGGCCGGG - Intergenic
1070005976 10:72424429-72424451 CTGAGTATGTACTATGGGCCAGG + Intronic
1070076701 10:73143357-73143379 CAGGGTTTCCCATATTGGCCAGG + Intronic
1070289805 10:75106757-75106779 CTGAGTATCCACTACGTGCCTGG - Intronic
1070730940 10:78827932-78827954 CACAGTTGAAACTATGGGCCAGG + Intergenic
1071502053 10:86211167-86211189 CTGAGTTGCTACTATGTGCCAGG - Intronic
1071566572 10:86674330-86674352 CACAGGTGCCAGTATGGGCCGGG - Intronic
1072618707 10:97066230-97066252 CTGAGTGGCCACTGTGGGCCAGG - Intronic
1075209317 10:120477760-120477782 CTGAGTATCTACTATGTGCCAGG - Intronic
1078914757 11:15768979-15769001 TAGAGTGTCCACTATGCACCAGG - Intergenic
1078946903 11:16078555-16078577 TTGAGTTGCTACTATGGGCCAGG + Intronic
1079298591 11:19257105-19257127 TAGAGTTCCCACAATGGGCCAGG - Intergenic
1080424934 11:32146629-32146651 CAGAGTTTCCCCAATTGACCAGG - Intergenic
1081662548 11:44896860-44896882 CTGAGTTGCTACTATGTGCCAGG - Intronic
1082276245 11:50225040-50225062 CAGAGTTTCCTCTGTTGCCCAGG + Intergenic
1082879117 11:58021179-58021201 CTGAGTAGCCACTCTGGGCCAGG - Intergenic
1082919893 11:58481777-58481799 AAGAGTATCCACTGTAGGCCAGG - Intergenic
1083294030 11:61705708-61705730 CAGAGTGCCTACTATGTGCCAGG - Intronic
1083687180 11:64383520-64383542 CAGAGTACCTACTATGTGCCAGG - Intergenic
1083999174 11:66286942-66286964 CTGGGTGTCCACGATGGGCCTGG + Intronic
1085045455 11:73350268-73350290 CTGAGTGCCCACTATGTGCCAGG + Intronic
1085062961 11:73465042-73465064 TTGAGTGTCCACTATGAGCCAGG + Intronic
1085083774 11:73653412-73653434 CTGAGCTGCTACTATGGGCCAGG + Intronic
1085809483 11:79667364-79667386 CAGGGTTGCCAGCATGGGCCTGG + Intergenic
1086145939 11:83551848-83551870 CATAGTCTCTACTATGTGCCAGG + Intronic
1087093773 11:94300914-94300936 CAGAGTATGCACTCTGGGCCAGG + Intergenic
1088562388 11:111128499-111128521 CTGAGCTTCTACTATGTGCCAGG - Intergenic
1088578372 11:111294597-111294619 CACAGATTCTACTATGGGCCAGG + Intergenic
1090247336 11:125225657-125225679 CAGGGTTTCCAGTCTGGGGCTGG + Intronic
1091155092 11:133364745-133364767 CAGAGTTCTCACTAAGTGCCAGG - Intronic
1092017106 12:5168712-5168734 TAAAGTTTCCACTGTGAGCCAGG - Intergenic
1092265317 12:6976427-6976449 AAGAGTTTCCCCTTTGGGCCGGG + Exonic
1093133419 12:15419850-15419872 AAGAGTGTCCCCTCTGGGCCGGG + Intronic
1094135651 12:27122807-27122829 CAGAATTTCCAGTATTGGTCCGG + Intergenic
1095329667 12:40943334-40943356 CTGACCTTCCACTATGGGACAGG - Intronic
1096958050 12:55546856-55546878 CAGAGTCCCCACCATGGGGCTGG - Intergenic
1097381853 12:58904764-58904786 CTGAGCATCCACCATGGGCCAGG + Intronic
1097659302 12:62411385-62411407 TTGAGTGTCCACTATGTGCCAGG + Intronic
1097930153 12:65174691-65174713 CAGAGTGTCTACTATGTGCCCGG + Intronic
1101599317 12:106195205-106195227 CTGAGTTACCACCATGTGCCTGG + Intergenic
1106647115 13:31648031-31648053 TTGAGTTTCCACTATGTTCCAGG - Intergenic
1107179661 13:37444112-37444134 CAAATTTACCACTATGGACCAGG - Intergenic
1113277744 13:108751586-108751608 CAGAGTTTACAGTATGGAACGGG + Intronic
1114986782 14:28239179-28239201 TACAGTTTGCACCATGGGCCTGG + Intergenic
1117792070 14:59351533-59351555 CAGAGTGTATACTATGTGCCGGG - Intronic
1117924570 14:60764953-60764975 CAGAGTTTGGAATATAGGCCAGG + Intronic
1118372541 14:65149799-65149821 TTGAGTTTCTACTATGTGCCAGG - Intergenic
1119149745 14:72347642-72347664 TTGAGTATCCACTCTGGGCCAGG - Intronic
1119568958 14:75653118-75653140 TATTGTTTCCACAATGGGCCAGG - Intronic
1119709308 14:76809814-76809836 CAAAGTATTCACTATGTGCCAGG + Intronic
1120902224 14:89585523-89585545 CTGAGCATCTACTATGGGCCAGG + Intronic
1121605403 14:95236594-95236616 CAGTGTTGCCACTCTGAGCCGGG - Intronic
1122207173 14:100153582-100153604 CAGAGTTCCCAGGCTGGGCCAGG - Intronic
1122750911 14:103932277-103932299 CCAAGTATCCACTATGTGCCAGG - Intronic
1122977195 14:105175693-105175715 CAGCATTTCCACGCTGGGCCAGG - Intronic
1202905595 14_GL000194v1_random:70015-70037 CAGAGTTTCACATATTGGCCAGG - Intergenic
1124363277 15:29054247-29054269 CAGGGTGTGCACTGTGGGCCAGG - Exonic
1125561897 15:40640285-40640307 CAGGGTTTCACCTATTGGCCAGG + Intronic
1125641095 15:41231258-41231280 CAGTGTTTCCACTGCGGACCCGG - Exonic
1125790513 15:42362010-42362032 CTGAGTACCCACTATGGGACTGG - Intronic
1125886175 15:43231174-43231196 CTGAGTTTCTACTAGGGGCCAGG - Intergenic
1126586873 15:50297547-50297569 AAAAGATTCCACTATGGGCCGGG + Intronic
1127490373 15:59456599-59456621 CAGAGTCTCCTCTATTGCCCAGG + Intronic
1127618347 15:60709248-60709270 CTGAGTTTCTACTATGTGCCTGG + Intronic
1128323161 15:66706444-66706466 AAGAGTTTCCAGTATGTGCCAGG + Intronic
1128741511 15:70087137-70087159 CTGTGTATCCAGTATGGGCCAGG + Intronic
1128878310 15:71220563-71220585 ATGAGTGTCCACTATGGGCCAGG - Intronic
1128878315 15:71220603-71220625 TTGAGCATCCACTATGGGCCAGG - Intronic
1131195765 15:90353260-90353282 AAGAGTTTTCAGTATTGGCCAGG - Intronic
1132342212 15:101085915-101085937 CAGAGTGTCCATTATCAGCCAGG - Intergenic
1132492685 16:242122-242144 CAGAGTTTCCACTCAGGACTGGG + Intronic
1132949325 16:2551855-2551877 CGGGGTTTCAACTATTGGCCAGG + Intronic
1133826065 16:9279298-9279320 CTGAGTATCTACTATGTGCCGGG - Intergenic
1133935701 16:10267539-10267561 CAGAGTTTACCATATTGGCCAGG - Intergenic
1134828587 16:17305031-17305053 CAGGGTGCCCACTGTGGGCCGGG + Intronic
1134845392 16:17435663-17435685 CAAAGTTCCTACTATGTGCCAGG + Intronic
1135150855 16:20004499-20004521 CTGAGTGTCTACTATGAGCCAGG + Intergenic
1136101452 16:27999519-27999541 TAGAGTTCCCATGATGGGCCAGG - Intronic
1136669160 16:31839998-31840020 CAGACTATCCCCTATGGACCAGG + Intergenic
1136686456 16:31997418-31997440 CTGAGTATCCACTGTGTGCCAGG - Intergenic
1136787067 16:32940947-32940969 CTGAGTATCCACTGTGTGCCAGG - Intergenic
1136872445 16:33819988-33820010 CACAGCTTCCACTCTGAGCCTGG - Intergenic
1136882707 16:33912842-33912864 CAGAGTATCCACTGTGTGCCAGG + Intergenic
1140028052 16:71309964-71309986 CAGAGTGCTCACTATGTGCCAGG + Intergenic
1140288590 16:73628575-73628597 CTGAGTATCTACTATGGGCAAGG - Intergenic
1140892544 16:79297646-79297668 CTGAGTGCTCACTATGGGCCAGG - Intergenic
1142001689 16:87667934-87667956 CAGAGTGTCCACCAAGGGCAGGG - Intronic
1203089304 16_KI270728v1_random:1202617-1202639 CTGAGTATCCACTGTGTGCCAGG - Intergenic
1203099727 16_KI270728v1_random:1296080-1296102 CACAGCTTCCACTCTGAGCCTGG + Intergenic
1142489587 17:269691-269713 CTGAGTGCCCACTAAGGGCCAGG - Intronic
1142826994 17:2519627-2519649 CAGAGTCTCCTCTGTGGCCCAGG + Intergenic
1142965814 17:3580352-3580374 CTGAGGTCCCACTATGTGCCAGG + Intronic
1143281913 17:5761131-5761153 CAGAGTTTCACCTGTTGGCCAGG + Intergenic
1146189056 17:30748970-30748992 CAGGGTTTCACCTATTGGCCAGG + Intergenic
1146333945 17:31953300-31953322 CAGGGTTTCACCTATTGGCCAGG + Intronic
1146568466 17:33933393-33933415 CTGAGTATCCAGTATGTGCCAGG - Intronic
1146642700 17:34553174-34553196 TAAAGTGTCCACTATGGGCCAGG - Intergenic
1147848346 17:43421310-43421332 CATAGTGTCTACTATGTGCCTGG - Intergenic
1147955887 17:44134267-44134289 CAGAGTGTCCTCTCTGGGCAGGG + Intergenic
1148107472 17:45127115-45127137 CTGAGCACCCACTATGGGCCAGG - Intronic
1148579739 17:48735310-48735332 CAGAATTTACACTGTGGGGCTGG - Intergenic
1149007662 17:51822225-51822247 CAGAGTTTTCAATGTTGGCCAGG - Intronic
1149631980 17:58133627-58133649 CATAATATCCACAATGGGCCAGG + Intergenic
1150739420 17:67767455-67767477 CAGAGTTTCACCTATTGGCCTGG + Intergenic
1151773457 17:76180502-76180524 CTGAGTATCTACTATGTGCCAGG + Intronic
1151872019 17:76842835-76842857 CGGAGTTTCAACTGTTGGCCAGG - Intergenic
1152084291 17:78208120-78208142 AAGAATTTCCACTGTGGGCTGGG + Intergenic
1153179781 18:2420187-2420209 TTGAGTGTTCACTATGGGCCAGG + Intergenic
1153759953 18:8320873-8320895 TAGAGTTTCCAGTATGAACCTGG + Intronic
1155334654 18:24751511-24751533 CAGAGTTTCCCCTAAGTGCCTGG - Intergenic
1156976578 18:43228893-43228915 CAGAGTTTCCACTATGCTCTGGG + Intergenic
1157238132 18:45983146-45983168 CATAGTCTCTACTATGTGCCAGG + Intergenic
1157399338 18:47373955-47373977 CTGAGTTACTTCTATGGGCCAGG - Intergenic
1158667819 18:59448859-59448881 CAGAGTCACCACTGTGTGCCTGG + Intronic
1159591263 18:70337954-70337976 CATAGTATTCACTCTGGGCCAGG - Intronic
1160278155 18:77459093-77459115 GAGAGTTTCCACTCCAGGCCTGG - Intergenic
1161604171 19:5205484-5205506 CAAAGACTCCACAATGGGCCGGG + Intronic
1162859305 19:13493655-13493677 CAGAGTTTCAATTATGGGCTTGG + Intronic
1164478291 19:28591988-28592010 CAGAGTTGCCACCCTGGGTCAGG + Intergenic
1164799803 19:31067220-31067242 CAGAGTCTGCTCTAGGGGCCTGG - Intergenic
1166385851 19:42380384-42380406 GTGAGTCTCCATTATGGGCCAGG + Intergenic
925153415 2:1632890-1632912 CTGAGTATCCACCATGTGCCAGG - Exonic
925907621 2:8548583-8548605 CTGAGTGTCCACTCTGTGCCGGG - Intergenic
926791352 2:16574960-16574982 AAGAGTTTACACTGTGTGCCTGG + Intronic
927714716 2:25343897-25343919 CTGAGTGTCTACTATGTGCCAGG + Intergenic
927796992 2:26058036-26058058 CTGAGTATCTACTATGGTCCAGG - Intronic
931798630 2:65736676-65736698 CAGAGTTTCTACTGTGGTACTGG - Intergenic
932681216 2:73827475-73827497 CTGAGTGTCTACTATGTGCCAGG - Intergenic
933575214 2:84059392-84059414 CAGAGTTCCTATTATGTGCCAGG - Intergenic
934726063 2:96619757-96619779 CAGAGTTTCCCTTATAGGACTGG - Exonic
935800248 2:106688738-106688760 TAGAGTTTCTACTATGTGCCAGG + Intergenic
937706967 2:124932106-124932128 CATAGTTCCCACTATGGGCCAGG + Intergenic
939629091 2:144513408-144513430 CAGAGTTTCCACTAAAGGGTTGG - Intronic
942347776 2:175020934-175020956 TTGAGTGTCCACTATGTGCCTGG + Intergenic
942782842 2:179666698-179666720 TTGAGTTTCCATTCTGGGCCAGG + Intronic
943561579 2:189469902-189469924 CTGTGTTCCTACTATGGGCCAGG - Intronic
944144010 2:196486555-196486577 CTGAGCCTCCTCTATGGGCCCGG + Intronic
944529797 2:200656128-200656150 CAGTGGTTCCACTGTGGTCCGGG - Intronic
946270813 2:218591940-218591962 CAGAGTACCTACTATGTGCCCGG - Intronic
946662646 2:222018160-222018182 CTGAGTGTTCACCATGGGCCAGG - Intergenic
947179361 2:227398470-227398492 TTGTGTTTCTACTATGGGCCAGG - Intergenic
947803627 2:232949259-232949281 CAGAGTGCCCACTATGATCCAGG - Intronic
1168981317 20:2006411-2006433 TTGAGTGTCTACTATGGGCCAGG - Intergenic
1169389064 20:5174694-5174716 CAGAGTTTCCTCTGTAGCCCAGG - Intronic
1170203156 20:13767229-13767251 AAGAGTTAACATTATGGGCCAGG + Intronic
1170421918 20:16201457-16201479 CAGGGTTTCCTCTCTGGGCTTGG + Intergenic
1171892239 20:30727227-30727249 CAGAGTTTCACATATTGGCCAGG + Intergenic
1172502691 20:35438113-35438135 GAGCATTTCCACTATGGGACTGG - Exonic
1173498714 20:43536927-43536949 CTGAGCATCTACTATGGGCCAGG + Intronic
1173557107 20:43974010-43974032 CAGATTTTCCACTGAGAGCCTGG + Intronic
1174682448 20:52421768-52421790 CTGAGTGCCCACTAGGGGCCAGG + Intergenic
1174715736 20:52756361-52756383 CTAAGTTTCTACTATGTGCCTGG + Intergenic
1174899782 20:54486793-54486815 CTGAGTTTCTACTATGAGTCAGG - Intronic
1175207981 20:57326634-57326656 CTGAGTTCTCCCTATGGGCCAGG - Intergenic
1175477887 20:59289664-59289686 TTGAGTCTCCACTATGTGCCAGG - Intergenic
1175543143 20:59760793-59760815 CAGTGTTTCTACTATGGGACAGG + Intronic
1175973762 20:62699954-62699976 CAGAGGTGCCAGCATGGGCCTGG - Intergenic
1176624960 21:9084785-9084807 CAGAGTTTCACATATTGGCCAGG - Intergenic
1179056044 21:37935516-37935538 CAGAGTGTACACTATAGGTCAGG - Intergenic
1179061257 21:37981657-37981679 AAGAGTTTCCACATTTGGCCAGG - Intronic
1179272303 21:39860954-39860976 CAGAGCTTCCAAAATGGGCCTGG + Intergenic
1182349790 22:29692800-29692822 CCGAGTTCCCACCATGCGCCAGG + Intronic
1182370846 22:29809586-29809608 CAGAGTTTCCCATGTTGGCCAGG - Intronic
1182837736 22:33357996-33358018 CAGAGCACCCACTCTGGGCCAGG - Intronic
1183350703 22:37333165-37333187 CAGAGTTGGAACTAAGGGCCAGG - Intergenic
1184621150 22:45678629-45678651 CAGAGTACCCAAAATGGGCCAGG - Intronic
949479767 3:4482459-4482481 TAAAGTATCCACTATGTGCCAGG + Intergenic
951689032 3:25376044-25376066 CAGAGTACTCCCTATGGGCCAGG - Intronic
951985034 3:28609873-28609895 CAGAGTTCCTACTCTGTGCCAGG + Intergenic
954943253 3:54394031-54394053 CAGAGTTACCACTATGAGGTAGG + Intronic
955095713 3:55795874-55795896 CAGAGTACCTACTATTGGCCAGG + Intronic
955152669 3:56383535-56383557 TTGAGTATCCACTATGTGCCAGG - Intronic
955413388 3:58670406-58670428 CTGAGCATCTACTATGGGCCAGG - Intergenic
957472099 3:80670994-80671016 CAAAGTTTCCTTTATTGGCCTGG - Intergenic
959430794 3:106252401-106252423 CTGAGTTTCCACTTTGGTCGGGG - Intergenic
961492400 3:127264864-127264886 GAGGGTTTCCACTTTGGGGCAGG + Intergenic
961798081 3:129424168-129424190 CTGAATGTCCACTTTGGGCCAGG - Intronic
962022137 3:131512312-131512334 CAGAGTGTCCATGATGGTCCAGG + Intergenic
963275403 3:143324794-143324816 CAGGGTTTCCTCTATCGCCCAGG - Intronic
967015234 3:185475658-185475680 CAGGGTTTCCCATATTGGCCAGG - Intronic
967084756 3:186084498-186084520 CAGAGTATCTTCGATGGGCCAGG + Intronic
967125227 3:186417315-186417337 ACGAGTTTCTACTATGTGCCAGG - Intergenic
967868274 3:194208068-194208090 CTGAGCTCCCACTATGGGCTGGG + Intergenic
970575070 4:17419193-17419215 GTGAGTTACCACCATGGGCCAGG + Intergenic
971633613 4:29028592-29028614 TTGAGTTTCTACTTTGGGCCAGG - Intergenic
972984153 4:44743439-44743461 CAGAGTGCCTACTATGTGCCAGG - Intergenic
977027131 4:91833941-91833963 CAGAGTTTCCACTGTGGTTTGGG + Intergenic
977534401 4:98240509-98240531 CAGAGTCTCCTCTGTCGGCCAGG + Intergenic
978545971 4:109873087-109873109 CAGAGTTGCCACTCTGCACCTGG + Intergenic
979051199 4:115935219-115935241 CAGAGTTTCACCTGTTGGCCAGG + Intergenic
979646291 4:123074284-123074306 CAGAGTTTCAGCTGTTGGCCAGG + Intronic
981419134 4:144529154-144529176 ATGAGTTTTCATTATGGGCCCGG + Intergenic
983121342 4:163889196-163889218 CAGAGTCCTCACTATGCGCCAGG + Intronic
983512010 4:168619056-168619078 CTGAGTGTCCACACTGGGCCAGG + Intronic
983874800 4:172863305-172863327 CACAGCTTCCACCATGGGCCTGG + Intronic
984262203 4:177455554-177455576 CAGAGTTTCCACTGTGAAGCGGG - Intergenic
984953625 4:185024510-185024532 CTGAGCATCCCCTATGGGCCAGG - Intergenic
985809000 5:2069415-2069437 CAGAGTTTCTACTTTTGACCGGG - Intergenic
986216620 5:5725506-5725528 GAGAATTTCCACAAAGGGCCAGG - Intergenic
986366755 5:7040653-7040675 CAGAATGCCCATTATGGGCCAGG + Intergenic
987488421 5:18548593-18548615 AAGAGCTTCCACTGTGTGCCTGG - Intergenic
988784226 5:34551139-34551161 CAGAGTGTTCACTACGTGCCAGG - Intergenic
988963887 5:36396244-36396266 CAGAGTTTCACCTGTTGGCCAGG + Intergenic
990953172 5:61318712-61318734 CAGTGTTTCCACTAAGGCACTGG + Intergenic
991777242 5:70097174-70097196 CTGAGTTCCCACTATAGGCCAGG + Intergenic
991856528 5:70972617-70972639 CTGAGTTCCCACTATAGGCCAGG + Intronic
993682333 5:90895183-90895205 CTGAGTTTCTAATATGGGCCAGG + Intronic
996331289 5:122331919-122331941 CTGAATTTCTGCTATGGGCCAGG - Intronic
997698247 5:135878310-135878332 CAGAGGTTCCCCTGTGGGTCTGG - Intronic
997723041 5:136095954-136095976 CTGAGTGTCTACTATGTGCCAGG + Intergenic
997975779 5:138440539-138440561 CAGAGGTACCACTGTGGCCCTGG - Intronic
998224913 5:140319473-140319495 CAGAGTTCCTACTATGTGCTAGG + Intergenic
998231885 5:140366129-140366151 CTGAGTGTCCACTGTGTGCCAGG + Exonic
998889398 5:146729997-146730019 GACAGTTTGCACTATGTGCCTGG + Intronic
1000338079 5:160256397-160256419 CTGAGTGCCTACTATGGGCCAGG - Intronic
1001086833 5:168706739-168706761 CAGAGTGCCACCTATGGGCCTGG - Intronic
1001090327 5:168735372-168735394 CAGAATTTCCACTAGAGTCCTGG + Intronic
1003094886 6:3134461-3134483 CAGGGTCTCCACTATTGCCCAGG + Intronic
1004737299 6:18420377-18420399 CTGAGTGTCTACTATGTGCCAGG + Intronic
1004825256 6:19412949-19412971 CTGAGCTTCCACTGTTGGCCAGG + Intergenic
1005404370 6:25470361-25470383 CAGAGTTCTCACCATGTGCCAGG - Intronic
1006130709 6:31867786-31867808 CAGAGGACCCACTATGTGCCAGG - Intronic
1008974228 6:57405718-57405740 CTGAGTAGCCACTATGTGCCAGG + Intronic
1009163117 6:60307241-60307263 CTGAGTACCCACTATGTGCCAGG + Intergenic
1009498251 6:64377051-64377073 GAGAGTATCCACTATGTGCCAGG - Intronic
1010534713 6:77012346-77012368 CTCAGTTTGCACTATTGGCCTGG - Intergenic
1011867926 6:91854339-91854361 GAGAGCCTCCACTATGGGCAGGG + Intergenic
1012078632 6:94727442-94727464 CAGAGTTTGCACTGTGCACCTGG - Intergenic
1013765199 6:113566167-113566189 CAGAATCTCCACCTTGGGCCAGG - Intergenic
1015206996 6:130651239-130651261 CAGAGTTTCTGCTGTGGGCATGG + Intergenic
1015402272 6:132799866-132799888 CTGAGTTACCACTTTGTGCCAGG + Intergenic
1015570452 6:134616045-134616067 TAGAGTGCCCACTATGTGCCAGG + Intergenic
1019087189 6:169489699-169489721 CAGCGTTTCCAGGATGGGCCTGG + Intronic
1019804449 7:3113023-3113045 AAGAGTTTCCACTGTGGGTATGG + Intergenic
1019943846 7:4311426-4311448 CTGAGTTTCCACTGTTGCCCTGG - Intergenic
1020012349 7:4813285-4813307 CAGTGTTTCCACTGGGGGCCTGG + Intronic
1020613438 7:10429063-10429085 ACGAGTTTCCACTGGGGGCCAGG - Intergenic
1020786788 7:12583670-12583692 CAGAGTTTCCACTATGGGCCAGG + Intronic
1021083140 7:16386827-16386849 CAGGGTTTCCCCTGTTGGCCAGG - Intronic
1022057460 7:26753721-26753743 CCGAGCATCCACTATGTGCCAGG + Intronic
1022798659 7:33753838-33753860 CTGACTTTCCACTATGTGCCTGG + Intergenic
1022817684 7:33929112-33929134 CAGAGTTTGCACTGTGAGCTGGG + Intronic
1023217974 7:37885738-37885760 AAGAGTTCCCCCTATGTGCCAGG - Intronic
1023309282 7:38867352-38867374 CAGGGTTTCACCTATTGGCCAGG - Intronic
1023868813 7:44251955-44251977 CAGATTTTCTGCTGTGGGCCGGG - Intronic
1024624085 7:51189295-51189317 CAGAGATTCCACTATGATCATGG + Intronic
1026009061 7:66622687-66622709 TTGAGTTTCTACTATGCGCCAGG + Intergenic
1027296636 7:76780279-76780301 CTGAGTATTCACTATGTGCCCGG - Intergenic
1027658893 7:80965225-80965247 TAAAATTTCAACTATGGGCCAGG - Intergenic
1027701046 7:81470503-81470525 CAGAGTTTCCTCTAAAGGCTTGG + Intergenic
1028234366 7:88342873-88342895 CTGAGTGTCAACTATGTGCCAGG + Intergenic
1030134977 7:106237977-106237999 CTGAGTGTCTACCATGGGCCAGG + Intergenic
1033287624 7:140056288-140056310 CAGAGTACCTACTGTGGGCCAGG + Intronic
1033822523 7:145151302-145151324 TTGAGTGTCCACTATGTGCCAGG - Intergenic
1034480294 7:151314679-151314701 CTGAGCACCCACTATGGGCCAGG - Intergenic
1037894263 8:22641387-22641409 CTGAGTTCCCACTCTGTGCCAGG - Intronic
1038075248 8:24065958-24065980 CTGAGTTTCCCCTATGTGCCAGG - Intergenic
1038601350 8:28946246-28946268 AAGAATATCCCCTATGGGCCGGG - Intronic
1043139731 8:76573253-76573275 CTGAGTGTCTACTATGTGCCGGG + Intergenic
1043820038 8:84851990-84852012 CAGAGTATCCACTATGTGTGAGG - Intronic
1044668696 8:94656514-94656536 AAGAGTTACCTTTATGGGCCGGG - Intronic
1044901616 8:96951920-96951942 AAGAGTTTACACTATGTGCCCGG + Intronic
1045562667 8:103280849-103280871 CTGAGTGTCCAGTATAGGCCTGG + Intergenic
1045583991 8:103510333-103510355 CAGATTTTCATCTATGTGCCTGG - Intronic
1045699837 8:104853054-104853076 CTGAGCTTACACTCTGGGCCAGG + Intronic
1046089137 8:109478272-109478294 CTGAGTATCCACTATGTGCCAGG + Intronic
1046096880 8:109573098-109573120 TAGACTTCCCACTATGTGCCAGG + Intergenic
1046336071 8:112788672-112788694 TAGAGTTTCCTCTATGTGCCAGG - Intronic
1046934142 8:119870195-119870217 CAGAGTCTCCTCTATCAGCCAGG - Intergenic
1047633649 8:126735527-126735549 CTGAGTTTTTACTATGTGCCAGG + Intergenic
1047985447 8:130228405-130228427 CAGAATATACACAATGGGCCAGG + Intronic
1047986906 8:130244760-130244782 AAGAGTGTCCCCTGTGGGCCAGG + Intronic
1048407822 8:134140981-134141003 TTGAGTTTCCACTATGCACCAGG - Intergenic
1049098853 8:140564940-140564962 ACGAGGTTTCACTATGGGCCGGG - Intronic
1049527946 8:143138512-143138534 CAGAGGTTCCACCAAGGGTCAGG - Intergenic
1050137320 9:2479965-2479987 CTGAGTTCTTACTATGGGCCAGG + Intergenic
1051720390 9:20030649-20030671 CAGACTTTTCAGTATGTGCCAGG + Intergenic
1051873485 9:21766426-21766448 TTGAGTTTCCACTATGTGCTAGG + Intergenic
1053619039 9:39797873-39797895 CTCAGTTCCCACTATGAGCCTGG + Intergenic
1053877204 9:42557222-42557244 CTCAGTTCCCACTATGAGCCTGG + Intergenic
1053906514 9:42849276-42849298 CAGAGTTTCACATATTGGCCAGG - Intergenic
1054234490 9:62544500-62544522 CTCAGTTCCCACTATGAGCCTGG - Intergenic
1054265117 9:62909556-62909578 CTCAGTTCCCACTATGAGCCTGG - Intergenic
1054356583 9:64068487-64068509 CAGAGTTTCACATATTGGCCAGG - Intergenic
1054951359 9:70855634-70855656 CAGATTTTCCACTAGAGGCTTGG - Intronic
1055160985 9:73127958-73127980 TAGAGTATCAACTATGGACCCGG - Intergenic
1055635505 9:78273719-78273741 CGGAGTCTCCTCTATGGCCCAGG - Intronic
1058714859 9:107714432-107714454 CAGAGTTTCACCTGTTGGCCAGG - Intergenic
1059543889 9:115157228-115157250 GTGATTTTCCACTTTGGGCCAGG + Intronic
1059609850 9:115880680-115880702 CTGAGTGTCCAGTATGTGCCTGG - Intergenic
1060170892 9:121460115-121460137 CAGAGCTTCGGCTATGGGACTGG - Intergenic
1060540907 9:124429451-124429473 CAGAGCATCCATTATGTGCCTGG - Intergenic
1060809955 9:126606119-126606141 CTGAGTGTCCACCACGGGCCGGG - Intergenic
1061602096 9:131677103-131677125 CAAAGTTTCTACTATGTGCTAGG + Intronic
1061981366 9:134105790-134105812 CAGGGTTTCTACTGTTGGCCAGG - Intergenic
1062548013 9:137072378-137072400 CAGAGCACCCACTGTGGGCCAGG - Intergenic
1203748127 Un_GL000218v1:55227-55249 CAGAGTTTCACATATTGGCCAGG - Intergenic
1186799866 X:13082226-13082248 CAGAGTTTCAGCTTTGGGCAAGG + Intergenic
1187092640 X:16113342-16113364 CTGAGTATTCACTATGTGCCAGG - Intergenic
1189287041 X:39858941-39858963 CAGAGTTTCCCTGCTGGGCCAGG - Intergenic
1190661961 X:52662783-52662805 CAGAGTTTCCCGTGTTGGCCAGG - Intronic
1192235848 X:69295504-69295526 CAGAGTGGCCACTATGGGTGGGG - Intergenic
1193607067 X:83581839-83581861 CAGGGTTTCTACTGTTGGCCAGG + Intergenic
1194082865 X:89489951-89489973 AATAGTTTGCACTATGTGCCTGG - Intergenic
1194659502 X:96614224-96614246 CAGAGTTTCACCAATTGGCCAGG - Intergenic
1197196227 X:123703863-123703885 CAGAGTTTCCTCTGTTGCCCAGG - Intronic
1199972067 X:152868593-152868615 GAAAGTTTCATCTATGGGCCAGG - Intronic
1200435517 Y:3145823-3145845 AATAGTTTGCACTATGTGCCTGG - Intergenic
1200842244 Y:7794615-7794637 CAGTGTTTCTACCAAGGGCCAGG + Intergenic
1201161476 Y:11170195-11170217 CAGAGTTTCACATATTGGCCAGG - Intergenic