ID: 1020788270

View in Genome Browser
Species Human (GRCh38)
Location 7:12594746-12594768
Sequence CCTGTCTTGCAGGCCTTGTA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 123
Summary {0: 1, 1: 0, 2: 1, 3: 8, 4: 113}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1020788264_1020788270 8 Left 1020788264 7:12594715-12594737 CCACAGACGACAAAGACGAGAGA 0: 1
1: 0
2: 1
3: 6
4: 113
Right 1020788270 7:12594746-12594768 CCTGTCTTGCAGGCCTTGTATGG 0: 1
1: 0
2: 1
3: 8
4: 113

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1020788270 Original CRISPR CCTGTCTTGCAGGCCTTGTA TGG Intronic
902397345 1:16139529-16139551 TCTGTCTTGCAGACCTTGTCAGG - Intronic
903364112 1:22795323-22795345 CCTGCCTTGGAGCCCTGGTAGGG - Intronic
905372698 1:37493045-37493067 CCTTTCTTGGAGGGCTTGTTGGG - Exonic
906800694 1:48734526-48734548 CCTGTCTTGTAGGGCTGGGAAGG - Intronic
909762516 1:79309534-79309556 CTTGTCTTGCAGGGCATGAAAGG + Intergenic
910386579 1:86689986-86690008 CCTGGCCTGTAGGCCCTGTATGG - Intergenic
910733326 1:90422732-90422754 CATTTCTTGCAGGACTTGTCTGG - Intergenic
912331504 1:108824231-108824253 CCTGTCTGGCAGGCTGTGGACGG + Intronic
915125210 1:153658915-153658937 CCTGTCTCTCTGGCTTTGTAGGG + Intronic
919077758 1:192833181-192833203 CCTGTCTTGCAGGCCCGTGAGGG + Intergenic
919430741 1:197488020-197488042 GCTTTCCTGCAGGCCTGGTAGGG + Intergenic
920060195 1:203222146-203222168 CCTGTCCAGCAGGCCCTGTTTGG - Intronic
920506491 1:206518764-206518786 CCTGTTTTGGAGGCCTTGAGTGG + Intronic
921063434 1:211606109-211606131 CATCCCATGCAGGCCTTGTACGG + Intergenic
1063446026 10:6117898-6117920 CCTGTCTTGCAGGTTGAGTAGGG + Intergenic
1069941939 10:71962606-71962628 CCTGTCCTGCAGGCCTTGTCTGG + Intergenic
1073037769 10:100576141-100576163 CCAGTCTTGAAGGTCTTGTGGGG - Intergenic
1073116226 10:101093413-101093435 CCTGTCTGGGAGGCTTTGGACGG + Intronic
1073179510 10:101575248-101575270 CCAGGCTTGCAGGCCTTGATGGG - Intronic
1073442656 10:103561704-103561726 CCTGCCTTGCAGGGATTGGAGGG + Intronic
1077200011 11:1302061-1302083 CCTGCCTTGAAGGCCCTGCAAGG + Intronic
1077540552 11:3144707-3144729 CCGGGCTTGCAGGATTTGTAAGG - Intronic
1078004984 11:7525861-7525883 CCTGTCTTACAAGCTTTGGAGGG + Intronic
1084748954 11:71191327-71191349 CCTGTCTGCCGGGCTTTGTACGG - Intronic
1085121830 11:73972369-73972391 CCTACCTTGCAGGCCTTTCATGG + Intergenic
1088420436 11:109639255-109639277 CTTGTCTTCCAGGGCTTTTACGG + Intergenic
1088578046 11:111290536-111290558 CATCTCTTTCAGGTCTTGTAAGG + Intergenic
1097225575 12:57475304-57475326 CCGCTCCTGCAGGCTTTGTAAGG + Exonic
1097263831 12:57734785-57734807 ACTGTCATCCAGGCCCTGTAGGG - Intronic
1098790815 12:74819600-74819622 CATGGCCTGCAGGCCTTATATGG - Intergenic
1099608819 12:84839217-84839239 CCTGTCTTGCAGGACTTGAGTGG - Intergenic
1103936833 12:124481476-124481498 CCTGCCATGCAGGCCCTGGAGGG + Intronic
1104293118 12:127486936-127486958 ACTTTTTTGCAGGCGTTGTACGG - Intergenic
1104965138 12:132505537-132505559 CCTGTCATGGTGGCCTTGGACGG + Intronic
1106922866 13:34582706-34582728 CCTTTCTCCCAGGCCTTCTAGGG + Intergenic
1107778312 13:43871894-43871916 GCTGTCTTACAGGTCTTGGAAGG + Intronic
1108546160 13:51496698-51496720 ACAGTCTTTCATGCCTTGTATGG + Intergenic
1112859333 13:103810746-103810768 TCAGTCTTGCAGGCCATCTAGGG + Intergenic
1113197266 13:107823187-107823209 CCTGCCTTTCAGGCCTAGTGTGG + Intronic
1115531701 14:34333844-34333866 CCTGTGTTCTGGGCCTTGTATGG - Intronic
1116014423 14:39389154-39389176 CCTATCTTGAAGGCCATGTTAGG + Intergenic
1116148491 14:41106067-41106089 CCAGTCTTGCAGTGATTGTAGGG + Intergenic
1121972879 14:98374961-98374983 AGTGTTTTGCAGGACTTGTATGG - Intergenic
1122790173 14:104181037-104181059 CCTGCCTTGCAGCCCCTGTGGGG + Intergenic
1123838875 15:24225729-24225751 CCTGACTTGCAGGCATTCTGTGG + Intergenic
1124371004 15:29104603-29104625 CATGTCTTGCAGGCCTGGCCTGG + Intronic
1133924871 16:10183919-10183941 TCTGCCTTTCAGGCCTTGGAAGG + Intergenic
1136060262 16:27721537-27721559 CTTCTCTTGCTGGCCTTCTAGGG + Exonic
1136993524 16:35172285-35172307 CCTCCCTGACAGGCCTTGTAGGG - Intergenic
1137564356 16:49524150-49524172 CCTGTCCTACAGGCCTGGGAGGG - Intronic
1147162937 17:38578502-38578524 CCTGTCCTGCTGGCCTCGCAGGG + Exonic
1151271713 17:73001711-73001733 CCTTGCTTGCTGGACTTGTATGG - Intronic
1151476084 17:74345031-74345053 CCTGTGGTGCTGGCCTTGCATGG - Intronic
1151745175 17:76008088-76008110 CCCCTCTTGTAGGCCTCGTATGG + Exonic
1153549548 18:6247309-6247331 CCTGCTTTGCAGGCGGTGTATGG - Intronic
1153664346 18:7354828-7354850 ACTGTCTTGCAGGCTTCCTAGGG + Intergenic
1154151698 18:11911094-11911116 CCTGACCTACAGGACTTGTACGG + Intergenic
1156417112 18:36907926-36907948 GATTTCTTACAGGCCTTGTATGG + Intronic
1157298801 18:46464852-46464874 CTTCTCTTGCAGGCATTGTCCGG + Intergenic
1161043321 19:2121552-2121574 CCTGTCTTCCAGGGCCTGTGTGG - Intronic
1162029546 19:7911460-7911482 TCCGTCTTGCAGTTCTTGTAGGG - Exonic
1167798794 19:51727167-51727189 CCTGTCTTTCAGCACTTGTCTGG - Intergenic
1168469455 19:56628842-56628864 CCTGGCTTGCAGCCTGTGTAGGG + Intergenic
926913942 2:17876140-17876162 TCTGTCTTCCAGGCCTCGTTTGG - Intergenic
929835108 2:45388950-45388972 TCTGCCTTGCTGGACTTGTATGG - Exonic
933796706 2:85925806-85925828 CCTCTCTTCCAGGCCTTGCTAGG + Intergenic
944095964 2:195968352-195968374 ACTGCCTTGAAGGCCTTGAAGGG - Intronic
947700668 2:232231653-232231675 GCTCTCTTGCAGACCTGGTATGG + Intronic
1175529706 20:59666083-59666105 CCTGTTGTGCATGCCTTGCAGGG + Intronic
1175791926 20:61745305-61745327 CCTGTCTTGCAAGCTTTCCATGG - Intronic
1176242574 20:64081847-64081869 ACTGTCTTGCTGGCCTTCTCTGG + Intronic
1179987143 21:44928173-44928195 CCTGTCTGGCAGCCCTTGCCAGG - Intronic
1181051129 22:20238785-20238807 CCTGTGTTGCAGGCCTAGCCAGG - Intergenic
1181159955 22:20953960-20953982 TCTGTCTTGTAGGTATTGTATGG + Intergenic
1181492166 22:23267382-23267404 CCCTTCTTGCAGCCCTTGTAGGG + Intronic
1181983948 22:26786238-26786260 CCTTTACTGCAGGCCTTGTCAGG + Intergenic
1182734035 22:32518145-32518167 CCTGGCTTGGAGGCCTGGTTTGG + Exonic
1184451505 22:44585541-44585563 CCTGCCCTGCAGGCCATGGAGGG + Intergenic
960520420 3:118648162-118648184 ACTTTCTTGCAGGGCTTGTGTGG - Intergenic
960686245 3:120296953-120296975 CCTGCCTTGCAGACCCTGTGGGG - Intergenic
962701208 3:138001191-138001213 CCTGGCTTGCAGCCCTAATAGGG + Intronic
963673106 3:148277335-148277357 CCTGACTGGCAGTCCTTCTATGG + Intergenic
969437120 4:7194552-7194574 CCTGACTAGCAGCCCTTGGAGGG + Intronic
971968338 4:33591821-33591843 CCTGTCCTCCAAGTCTTGTAAGG - Intergenic
975612033 4:76213276-76213298 CCTGTCTTCCAGGGCTTGGTAGG - Intronic
978250097 4:106620305-106620327 CCTGTAGGGCAGGCTTTGTAAGG + Intergenic
980452627 4:132994728-132994750 CCTGTCTTCCAGTCCCTGGAGGG - Intergenic
984560821 4:181267345-181267367 GCTGTCATGAAGGGCTTGTAAGG - Intergenic
986015694 5:3754965-3754987 GCTGGCTGGCAGGCCTTGTGGGG + Intergenic
989679047 5:44007770-44007792 AATGTCTTGCAGGCCTTTTCAGG - Intergenic
993956719 5:94243321-94243343 CCTGAATGGCAGGCCTTGCAGGG + Intronic
996907418 5:128616863-128616885 CCTGTCTACCTGGCCTGGTAGGG + Intronic
997261691 5:132470297-132470319 CCTGTCTGGCAGGACTTGAAGGG + Intronic
997364094 5:133314364-133314386 CCTGGGATGCAGGCCTTGAATGG + Intronic
997892595 5:137688270-137688292 CCTGTTATGCAGGCCTTCTGTGG - Intronic
997999072 5:138609943-138609965 GCTGTCTTGCAAGCCTTGGGAGG - Intergenic
998213863 5:140222741-140222763 CCTGTGTCTCAGGCCCTGTAGGG + Intronic
1002107983 5:176889579-176889601 CCTGGCTAGCAGGCCTTGACAGG - Intronic
1010574404 6:77513297-77513319 CCTGTCTTCCAAGTCTTGTAAGG + Intergenic
1010645788 6:78386543-78386565 CCTGTCTTTGAGGCTTTGCAGGG + Intergenic
1018931524 6:168243123-168243145 CCACGCTTGCAGGCCTTGTCGGG - Intergenic
1019719617 7:2560119-2560141 TCTGTCTCTCAGGCCTTGGAGGG - Intronic
1019761685 7:2817436-2817458 ACAGTCTTGCAGGCTGTGTAAGG - Intronic
1020788270 7:12594746-12594768 CCTGTCTTGCAGGCCTTGTATGG + Intronic
1030084382 7:105804187-105804209 CCTGTCTTGAAGGGCTTTTCTGG - Intronic
1030364501 7:108630128-108630150 ATTTTCTTGCAGGCCTTGGAGGG + Intergenic
1030563769 7:111124664-111124686 CCTGTCTTGGAGGCCTTCTGGGG + Exonic
1032310210 7:130779526-130779548 CCTGTCTTACAGGTCCTTTAGGG - Intergenic
1033113952 7:138608722-138608744 CTTTTCTTCCAGGCCTTCTATGG - Intronic
1033672845 7:143510153-143510175 CAGGTCTTGCAAGCCTTGTAAGG - Intergenic
1041008306 8:53516944-53516966 CCTCTCCCGCAGGCCTTCTACGG - Intergenic
1042118442 8:65458037-65458059 CCTGCTTTGCAGGCCTTGTCTGG - Intergenic
1045483272 8:102610035-102610057 CATGTGTGGCAGTCCTTGTAAGG - Intergenic
1050846708 9:10230193-10230215 CCTCCCTTGCAGTCCTTGGAAGG + Intronic
1055012270 9:71579795-71579817 ACTGTGGTGCTGGCCTTGTAGGG - Intergenic
1055182107 9:73401515-73401537 CCTGTCATGCAGGCCTAGATCGG + Intergenic
1056443119 9:86639970-86639992 ACTGGCATGCAGGCCATGTATGG + Intergenic
1058906605 9:109487135-109487157 ACTGTCCTGCAGGCCTTTTCAGG - Intronic
1062344783 9:136109682-136109704 CCTTCCGTGCAGTCCTTGTATGG - Intergenic
1187856627 X:23643101-23643123 CTTCTCTTGCAGCCCTTGGAAGG + Intergenic
1196106458 X:111901386-111901408 CCTTTGTTGCTGGCCTTGTGAGG - Intronic
1199282646 X:146020795-146020817 CCTGTCTTGCAGAATTTGCAGGG - Intergenic
1199896858 X:152135243-152135265 ACTGTCTGGCAGGACCTGTAGGG + Exonic