ID: 1020796476

View in Genome Browser
Species Human (GRCh38)
Location 7:12683821-12683843
Sequence GGAAACACAGTGACATCTGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1020796476_1020796482 22 Left 1020796476 7:12683821-12683843 CCAACAGATGTCACTGTGTTTCC No data
Right 1020796482 7:12683866-12683888 CAGAACCCCTAGGAATTCTGAGG No data
1020796476_1020796479 12 Left 1020796476 7:12683821-12683843 CCAACAGATGTCACTGTGTTTCC No data
Right 1020796479 7:12683856-12683878 AACTATCCCACAGAACCCCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1020796476 Original CRISPR GGAAACACAGTGACATCTGT TGG (reversed) Intergenic
No off target data available for this crispr