ID: 1020802656

View in Genome Browser
Species Human (GRCh38)
Location 7:12750488-12750510
Sequence GTTTTAATGTGGATTTTGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1020802649_1020802656 30 Left 1020802649 7:12750435-12750457 CCTAATCGTCTCCTGCAGGTGCC No data
Right 1020802656 7:12750488-12750510 GTTTTAATGTGGATTTTGGAAGG No data
1020802651_1020802656 9 Left 1020802651 7:12750456-12750478 CCACTTTCTAATACTGTCGCCTT No data
Right 1020802656 7:12750488-12750510 GTTTTAATGTGGATTTTGGAAGG No data
1020802650_1020802656 19 Left 1020802650 7:12750446-12750468 CCTGCAGGTGCCACTTTCTAATA No data
Right 1020802656 7:12750488-12750510 GTTTTAATGTGGATTTTGGAAGG No data
1020802653_1020802656 -10 Left 1020802653 7:12750475-12750497 CCTTGGTGATTACGTTTTAATGT No data
Right 1020802656 7:12750488-12750510 GTTTTAATGTGGATTTTGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1020802656 Original CRISPR GTTTTAATGTGGATTTTGGA AGG Intergenic
No off target data available for this crispr