ID: 1020803172

View in Genome Browser
Species Human (GRCh38)
Location 7:12756842-12756864
Sequence CTGGGAAAGGAGAAGGAAAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1020803166_1020803172 3 Left 1020803166 7:12756816-12756838 CCTCTAAGGTTACAAAGCCTATA No data
Right 1020803172 7:12756842-12756864 CTGGGAAAGGAGAAGGAAACTGG No data
1020803165_1020803172 4 Left 1020803165 7:12756815-12756837 CCCTCTAAGGTTACAAAGCCTAT No data
Right 1020803172 7:12756842-12756864 CTGGGAAAGGAGAAGGAAACTGG No data
1020803164_1020803172 5 Left 1020803164 7:12756814-12756836 CCCCTCTAAGGTTACAAAGCCTA No data
Right 1020803172 7:12756842-12756864 CTGGGAAAGGAGAAGGAAACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1020803172 Original CRISPR CTGGGAAAGGAGAAGGAAAC TGG Intergenic
No off target data available for this crispr