ID: 1020804102

View in Genome Browser
Species Human (GRCh38)
Location 7:12767051-12767073
Sequence ACCGTGCCCGGCCTTCAAAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1020804102_1020804108 10 Left 1020804102 7:12767051-12767073 CCACTTTGAAGGCCGGGCACGGT No data
Right 1020804108 7:12767084-12767106 TGTAATCCCAGCACTTTGGGAGG No data
1020804102_1020804106 7 Left 1020804102 7:12767051-12767073 CCACTTTGAAGGCCGGGCACGGT No data
Right 1020804106 7:12767081-12767103 GCCTGTAATCCCAGCACTTTGGG No data
1020804102_1020804105 6 Left 1020804102 7:12767051-12767073 CCACTTTGAAGGCCGGGCACGGT No data
Right 1020804105 7:12767080-12767102 AGCCTGTAATCCCAGCACTTTGG No data
1020804102_1020804111 20 Left 1020804102 7:12767051-12767073 CCACTTTGAAGGCCGGGCACGGT No data
Right 1020804111 7:12767094-12767116 GCACTTTGGGAGGCCGAGACAGG No data
1020804102_1020804112 23 Left 1020804102 7:12767051-12767073 CCACTTTGAAGGCCGGGCACGGT No data
Right 1020804112 7:12767097-12767119 CTTTGGGAGGCCGAGACAGGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1020804102 Original CRISPR ACCGTGCCCGGCCTTCAAAG TGG (reversed) Intergenic