ID: 1020805136

View in Genome Browser
Species Human (GRCh38)
Location 7:12780444-12780466
Sequence CTTCCAGGAACCAGAACTAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1020805136_1020805140 1 Left 1020805136 7:12780444-12780466 CCTCTAGTTCTGGTTCCTGGAAG No data
Right 1020805140 7:12780468-12780490 GAAGCAGGACCCATAGTGGCAGG No data
1020805136_1020805139 -3 Left 1020805136 7:12780444-12780466 CCTCTAGTTCTGGTTCCTGGAAG No data
Right 1020805139 7:12780464-12780486 AAGAGAAGCAGGACCCATAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1020805136 Original CRISPR CTTCCAGGAACCAGAACTAG AGG (reversed) Intergenic
No off target data available for this crispr