ID: 1020805784

View in Genome Browser
Species Human (GRCh38)
Location 7:12789053-12789075
Sequence GTTATGTAACATGTTAACAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1020805783_1020805784 9 Left 1020805783 7:12789021-12789043 CCAATGCGAATTTATAATAATAT No data
Right 1020805784 7:12789053-12789075 GTTATGTAACATGTTAACACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1020805784 Original CRISPR GTTATGTAACATGTTAACAC TGG Intergenic
No off target data available for this crispr