ID: 1020816652

View in Genome Browser
Species Human (GRCh38)
Location 7:12913905-12913927
Sequence CCTCCTGTGTAGAACAAGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1020816652_1020816655 -7 Left 1020816652 7:12913905-12913927 CCTTCCTTGTTCTACACAGGAGG No data
Right 1020816655 7:12913921-12913943 CAGGAGGAAATCAAGTTACCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1020816652 Original CRISPR CCTCCTGTGTAGAACAAGGA AGG (reversed) Intergenic
No off target data available for this crispr