ID: 1020818717

View in Genome Browser
Species Human (GRCh38)
Location 7:12939334-12939356
Sequence CTCCAACAGACGTGCAGCTA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 8232
Summary {0: 2, 1: 104, 2: 3995, 3: 2916, 4: 1215}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1020818717_1020818722 14 Left 1020818717 7:12939334-12939356 CCTTAGCTGCACGTCTGTTGGAG 0: 2
1: 104
2: 3995
3: 2916
4: 1215
Right 1020818722 7:12939371-12939393 ACTTCAGACCCTGTTTGCCTGGG 0: 76
1: 3013
2: 2335
3: 1105
4: 629
1020818717_1020818726 29 Left 1020818717 7:12939334-12939356 CCTTAGCTGCACGTCTGTTGGAG 0: 2
1: 104
2: 3995
3: 2916
4: 1215
Right 1020818726 7:12939386-12939408 TGCCTGGGTATCACCAGTGGAGG 0: 466
1: 1343
2: 2211
3: 1972
4: 953
1020818717_1020818725 26 Left 1020818717 7:12939334-12939356 CCTTAGCTGCACGTCTGTTGGAG 0: 2
1: 104
2: 3995
3: 2916
4: 1215
Right 1020818725 7:12939383-12939405 GTTTGCCTGGGTATCACCAGTGG 0: 902
1: 2121
2: 1266
3: 497
4: 234
1020818717_1020818721 13 Left 1020818717 7:12939334-12939356 CCTTAGCTGCACGTCTGTTGGAG 0: 2
1: 104
2: 3995
3: 2916
4: 1215
Right 1020818721 7:12939370-12939392 CACTTCAGACCCTGTTTGCCTGG 0: 70
1: 3025
2: 2359
3: 1120
4: 754

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1020818717 Original CRISPR CTCCAACAGACGTGCAGCTA AGG (reversed) Intergenic
Too many off-targets to display for this crispr