ID: 1020819078

View in Genome Browser
Species Human (GRCh38)
Location 7:12943253-12943275
Sequence TAATACCCACATGTGGAACT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1020819070_1020819078 30 Left 1020819070 7:12943200-12943222 CCACCTAAATATCATTTCAAATT No data
Right 1020819078 7:12943253-12943275 TAATACCCACATGTGGAACTGGG No data
1020819074_1020819078 0 Left 1020819074 7:12943230-12943252 CCACATGTCAAAAGAGGGACCTG No data
Right 1020819078 7:12943253-12943275 TAATACCCACATGTGGAACTGGG No data
1020819071_1020819078 27 Left 1020819071 7:12943203-12943225 CCTAAATATCATTTCAAATTGTA No data
Right 1020819078 7:12943253-12943275 TAATACCCACATGTGGAACTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1020819078 Original CRISPR TAATACCCACATGTGGAACT GGG Intergenic
No off target data available for this crispr