ID: 1020825780

View in Genome Browser
Species Human (GRCh38)
Location 7:13026068-13026090
Sequence GAGGTTCCTTACCCATTTGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1020825780_1020825786 28 Left 1020825780 7:13026068-13026090 CCCACAAATGGGTAAGGAACCTC No data
Right 1020825786 7:13026119-13026141 TTGATACCAGTATTGGGTCTTGG No data
1020825780_1020825784 21 Left 1020825780 7:13026068-13026090 CCCACAAATGGGTAAGGAACCTC No data
Right 1020825784 7:13026112-13026134 GGAAATATTGATACCAGTATTGG No data
1020825780_1020825785 22 Left 1020825780 7:13026068-13026090 CCCACAAATGGGTAAGGAACCTC No data
Right 1020825785 7:13026113-13026135 GAAATATTGATACCAGTATTGGG No data
1020825780_1020825787 29 Left 1020825780 7:13026068-13026090 CCCACAAATGGGTAAGGAACCTC No data
Right 1020825787 7:13026120-13026142 TGATACCAGTATTGGGTCTTGGG No data
1020825780_1020825783 0 Left 1020825780 7:13026068-13026090 CCCACAAATGGGTAAGGAACCTC No data
Right 1020825783 7:13026091-13026113 AACATTATAGTCATCAATACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1020825780 Original CRISPR GAGGTTCCTTACCCATTTGT GGG (reversed) Intergenic
No off target data available for this crispr