ID: 1020825870

View in Genome Browser
Species Human (GRCh38)
Location 7:13027278-13027300
Sequence AGTTGGTATATGTAAGGTCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1020825867_1020825870 7 Left 1020825867 7:13027248-13027270 CCAAAGATAGTAGAAAAGCATCT No data
Right 1020825870 7:13027278-13027300 AGTTGGTATATGTAAGGTCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1020825870 Original CRISPR AGTTGGTATATGTAAGGTCC AGG Intergenic
No off target data available for this crispr