ID: 1020828891 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 7:13067836-13067858 |
Sequence | ACAGAGAAGCTACATTTTGG AGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | No data | |||
Summary | No data |
Found 1 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1020828887_1020828891 | 11 | Left | 1020828887 | 7:13067802-13067824 | CCGGGAGCAAAGATATTGGGTGG | No data | ||
Right | 1020828891 | 7:13067836-13067858 | ACAGAGAAGCTACATTTTGGAGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1020828891 | Original CRISPR | ACAGAGAAGCTACATTTTGG AGG | Intergenic | ||
No off target data available for this crispr |