ID: 1020828891

View in Genome Browser
Species Human (GRCh38)
Location 7:13067836-13067858
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1020828887_1020828891 11 Left 1020828887 7:13067802-13067824 CCGGGAGCAAAGATATTGGGTGG No data
Right 1020828891 7:13067836-13067858 ACAGAGAAGCTACATTTTGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1020828891 Original CRISPR ACAGAGAAGCTACATTTTGG AGG Intergenic
No off target data available for this crispr