ID: 1020832601

View in Genome Browser
Species Human (GRCh38)
Location 7:13110304-13110326
Sequence GAGAAGCACTGGAGGGAGGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1020832601_1020832606 -8 Left 1020832601 7:13110304-13110326 CCAACCTCCCTCCAGTGCTTCTC No data
Right 1020832606 7:13110319-13110341 TGCTTCTCAGCGACCAAAGTCGG No data
1020832601_1020832609 -2 Left 1020832601 7:13110304-13110326 CCAACCTCCCTCCAGTGCTTCTC No data
Right 1020832609 7:13110325-13110347 TCAGCGACCAAAGTCGGAAGGGG No data
1020832601_1020832610 4 Left 1020832601 7:13110304-13110326 CCAACCTCCCTCCAGTGCTTCTC No data
Right 1020832610 7:13110331-13110353 ACCAAAGTCGGAAGGGGCCAAGG No data
1020832601_1020832607 -4 Left 1020832601 7:13110304-13110326 CCAACCTCCCTCCAGTGCTTCTC No data
Right 1020832607 7:13110323-13110345 TCTCAGCGACCAAAGTCGGAAGG No data
1020832601_1020832612 14 Left 1020832601 7:13110304-13110326 CCAACCTCCCTCCAGTGCTTCTC No data
Right 1020832612 7:13110341-13110363 GAAGGGGCCAAGGTGTCACGAGG No data
1020832601_1020832615 26 Left 1020832601 7:13110304-13110326 CCAACCTCCCTCCAGTGCTTCTC No data
Right 1020832615 7:13110353-13110375 GTGTCACGAGGCTGGTGTGTTGG No data
1020832601_1020832608 -3 Left 1020832601 7:13110304-13110326 CCAACCTCCCTCCAGTGCTTCTC No data
Right 1020832608 7:13110324-13110346 CTCAGCGACCAAAGTCGGAAGGG No data
1020832601_1020832613 18 Left 1020832601 7:13110304-13110326 CCAACCTCCCTCCAGTGCTTCTC No data
Right 1020832613 7:13110345-13110367 GGGCCAAGGTGTCACGAGGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1020832601 Original CRISPR GAGAAGCACTGGAGGGAGGT TGG (reversed) Intergenic
No off target data available for this crispr