ID: 1020833232

View in Genome Browser
Species Human (GRCh38)
Location 7:13116638-13116660
Sequence CTGAAGAAAGAGATGGAAAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1020833232_1020833237 18 Left 1020833232 7:13116638-13116660 CCATTTTCCATCTCTTTCTTCAG No data
Right 1020833237 7:13116679-13116701 TTTCTTTTGATAGTTTTCATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1020833232 Original CRISPR CTGAAGAAAGAGATGGAAAA TGG (reversed) Intergenic
No off target data available for this crispr