ID: 1020839480

View in Genome Browser
Species Human (GRCh38)
Location 7:13197545-13197567
Sequence CTAGCCCAACATGTTGAAAT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1020839478_1020839480 27 Left 1020839478 7:13197495-13197517 CCTTTCGCATGTCAAATTTCTGC No data
Right 1020839480 7:13197545-13197567 CTAGCCCAACATGTTGAAATAGG No data
1020839479_1020839480 -8 Left 1020839479 7:13197530-13197552 CCTAGCAGAATAATGCTAGCCCA No data
Right 1020839480 7:13197545-13197567 CTAGCCCAACATGTTGAAATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1020839480 Original CRISPR CTAGCCCAACATGTTGAAAT AGG Intergenic
No off target data available for this crispr