ID: 1020842099

View in Genome Browser
Species Human (GRCh38)
Location 7:13231327-13231349
Sequence AAAGACAATCCCCTTTAAAT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1020842098_1020842099 -2 Left 1020842098 7:13231306-13231328 CCAGAATTTAAATCTCTGAACAA No data
Right 1020842099 7:13231327-13231349 AAAGACAATCCCCTTTAAATTGG No data
1020842095_1020842099 9 Left 1020842095 7:13231295-13231317 CCCTTTGATTCCCAGAATTTAAA No data
Right 1020842099 7:13231327-13231349 AAAGACAATCCCCTTTAAATTGG No data
1020842097_1020842099 -1 Left 1020842097 7:13231305-13231327 CCCAGAATTTAAATCTCTGAACA No data
Right 1020842099 7:13231327-13231349 AAAGACAATCCCCTTTAAATTGG No data
1020842096_1020842099 8 Left 1020842096 7:13231296-13231318 CCTTTGATTCCCAGAATTTAAAT No data
Right 1020842099 7:13231327-13231349 AAAGACAATCCCCTTTAAATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1020842099 Original CRISPR AAAGACAATCCCCTTTAAAT TGG Intergenic
No off target data available for this crispr