ID: 1020845765

View in Genome Browser
Species Human (GRCh38)
Location 7:13280773-13280795
Sequence GTAGTATAGCGAGCAAAACC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1020845763_1020845765 19 Left 1020845763 7:13280731-13280753 CCTAAAAGAAGTGTGGGAGTGCT No data
Right 1020845765 7:13280773-13280795 GTAGTATAGCGAGCAAAACCTGG No data
1020845764_1020845765 -9 Left 1020845764 7:13280759-13280781 CCTGATGACATTGAGTAGTATAG No data
Right 1020845765 7:13280773-13280795 GTAGTATAGCGAGCAAAACCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1020845765 Original CRISPR GTAGTATAGCGAGCAAAACC TGG Intergenic
No off target data available for this crispr