ID: 1020849257

View in Genome Browser
Species Human (GRCh38)
Location 7:13329758-13329780
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1020849257_1020849258 24 Left 1020849257 7:13329758-13329780 CCTAAATAGATGTGCATAACTAA No data
Right 1020849258 7:13329805-13329827 ATGAATTTCCAAATTTTCTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1020849257 Original CRISPR TTAGTTATGCACATCTATTT AGG (reversed) Intergenic
No off target data available for this crispr