ID: 1020849789

View in Genome Browser
Species Human (GRCh38)
Location 7:13337782-13337804
Sequence AGCCAGGATCCCCCTACAGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1020849789_1020849792 3 Left 1020849789 7:13337782-13337804 CCAGCTGTAGGGGGATCCTGGCT No data
Right 1020849792 7:13337808-13337830 GTTTTAAACTTCTCTACACGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1020849789 Original CRISPR AGCCAGGATCCCCCTACAGC TGG (reversed) Intergenic
No off target data available for this crispr