ID: 1020850708

View in Genome Browser
Species Human (GRCh38)
Location 7:13348887-13348909
Sequence AAGTGGTAAAAGAAGGAAGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1020850702_1020850708 28 Left 1020850702 7:13348836-13348858 CCTCTTGGTGGATTATTCTAATT No data
Right 1020850708 7:13348887-13348909 AAGTGGTAAAAGAAGGAAGAGGG No data
1020850705_1020850708 -8 Left 1020850705 7:13348872-13348894 CCTTCGTAACTTAAAAAGTGGTA No data
Right 1020850708 7:13348887-13348909 AAGTGGTAAAAGAAGGAAGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1020850708 Original CRISPR AAGTGGTAAAAGAAGGAAGA GGG Intergenic
No off target data available for this crispr