ID: 1020852292

View in Genome Browser
Species Human (GRCh38)
Location 7:13369882-13369904
Sequence CAGTAGTTATTGAAGGAAAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1020852290_1020852292 18 Left 1020852290 7:13369841-13369863 CCTGCTGCTCAGGATAATTTGTT No data
Right 1020852292 7:13369882-13369904 CAGTAGTTATTGAAGGAAAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1020852292 Original CRISPR CAGTAGTTATTGAAGGAAAA AGG Intergenic
No off target data available for this crispr