ID: 1020852474

View in Genome Browser
Species Human (GRCh38)
Location 7:13374222-13374244
Sequence CATTATGCATTATTGAAAGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1020852470_1020852474 12 Left 1020852470 7:13374187-13374209 CCACGTTCTTTATTTATTGATTT No data
Right 1020852474 7:13374222-13374244 CATTATGCATTATTGAAAGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1020852474 Original CRISPR CATTATGCATTATTGAAAGT GGG Intergenic
No off target data available for this crispr