ID: 1020853582

View in Genome Browser
Species Human (GRCh38)
Location 7:13389157-13389179
Sequence GGCTCTCTAGTCATTGAAAG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1020853578_1020853582 -10 Left 1020853578 7:13389144-13389166 CCCTGTACCTCCAGGCTCTCTAG No data
Right 1020853582 7:13389157-13389179 GGCTCTCTAGTCATTGAAAGAGG No data
1020853577_1020853582 -3 Left 1020853577 7:13389137-13389159 CCAGGTTCCCTGTACCTCCAGGC No data
Right 1020853582 7:13389157-13389179 GGCTCTCTAGTCATTGAAAGAGG No data
1020853575_1020853582 6 Left 1020853575 7:13389128-13389150 CCTCTTTTTCCAGGTTCCCTGTA No data
Right 1020853582 7:13389157-13389179 GGCTCTCTAGTCATTGAAAGAGG No data
1020853573_1020853582 24 Left 1020853573 7:13389110-13389132 CCATGGAGAACTGTTCTTCCTCT No data
Right 1020853582 7:13389157-13389179 GGCTCTCTAGTCATTGAAAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1020853582 Original CRISPR GGCTCTCTAGTCATTGAAAG AGG Intergenic