ID: 1020858003

View in Genome Browser
Species Human (GRCh38)
Location 7:13452795-13452817
Sequence GCTGAAAAGTTGTCCCCTTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1020858003_1020858008 29 Left 1020858003 7:13452795-13452817 CCTGAAGGGGACAACTTTTCAGC No data
Right 1020858008 7:13452847-13452869 GATGGAGCCATTTGTAGTTCAGG No data
1020858003_1020858009 30 Left 1020858003 7:13452795-13452817 CCTGAAGGGGACAACTTTTCAGC No data
Right 1020858009 7:13452848-13452870 ATGGAGCCATTTGTAGTTCAGGG No data
1020858003_1020858007 11 Left 1020858003 7:13452795-13452817 CCTGAAGGGGACAACTTTTCAGC No data
Right 1020858007 7:13452829-13452851 AGTTTGTAAAAATGTGCAGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1020858003 Original CRISPR GCTGAAAAGTTGTCCCCTTC AGG (reversed) Intergenic